Which of the following peptides will likely adopt an alpha helix? H-I-R-E-F A-D-L-E-E A-D-E-L-E C-V-D-E-F
Q: A peptide with the sequence isoleucine1-aspartate2-valine3-lysine4-proline5-glutamate6 is located at…
A: Amino acids combine to form proteins by the formation of peptide bond. Amino acids have a one amino…
Q: Which amino acid residue's backbone forms a hydrogen bond with the backbone of the fifth (5th)…
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: Which of the following disaccharide repeats is the most stable towards hydrolysis?…
A: Hydrolytic stability is the resistance of a cured polymer material to reverting to a semisolid or…
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…
A: Small molecules called amino acids form the building blocks of proteins. In chemistry, an amino acid…
Q: The β-sheet structure is the secondary structure of the protein which is a sideways folded structure…
A:
Q: The peptide below NH-CH- HẠN CH- ČH, -NH-CH- NH-CH- NH-CH- OH CH2 CH2 CH2 HN-ç=NH, NH2 CH2 CH HO-CH,…
A: Amino acids are the building blocks of peptides. The net charge on a peptide depends on the sequence…
Q: For the protein given in the attached picture: Write the name of these 5 amino acids corresponding…
A: Proteins are composed of amino acids attached together via peptide bonds. The linear structure of…
Q: Peptide #1: L-I-T-V Peptide #2: C-Q-H-R Peptide #3: E-G-E-A Which peptide is the most basic?…
A: Amino acids are the building blocks of protein. An amino acid contains a carboxylic acid and a-amino…
Q: . Vwhat do you think holds together the various secondary structural elements in a Stickular…
A: These questions are about interactions in amino acids.
Q: Answer the below questions based on the following peptide sequence:…
A: Hi! Thanks for your question. The first and the last question will have the same explanation.…
Q: A nonapeptide was treated with dithiothreitol to reduce any disulfide bridges, then partially…
A: Amino acids are the basic unit of the peptide and proteins. They are joined via the peptide bonds to…
Q: A peptide has the following sequence: Gly-Ala-Lys-Phe-Asp-Met-Val-Pro-Arg-Ala-Leu. What Type your…
A: Proteins are the macromolecule that act as building block of body. It is formed from numerous amino…
Q: How long is a fully extended peptide chain that contains the same number of amino acids?(The…
A: Suppose a polypeptide is composed of 36 residues. The distance between two residues in fully…
Q: The keto form of 5-bromouracil will replace Thymine to base pair with Adenine. Which nucleotide will…
A: Nucleotides are organic molecules that contain phosphate groups and nucleotides. DNA and RNA are…
Q: What is the function of this macromolecule? HH H H H H H H AA -c-c-c-c-c-c-H H-C-o H H HHHHH H HHHHH…
A: Biomolecules are the substances produced by living organisms to sustain their metabolism and other…
Q: Part a) Draw the peptide C-H-A-R-G-E-D. What is its total charge at pH 7. Part b) Draw the…
A: The organic molecule is comprised of two functional groups that are an amino group and the carboxyl…
Q: Which one of the following statements is CORRECT? O The B-sheet is stabilized by ionic interactions…
A: Protein is biopolymers made up of amino acids and constitute 50% of the mass of the average human.…
Q: Which of the following is most likely to be an RNA nucleotide? a. Adenosine-5'-triphosphate b.…
A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…
Q: Given the polypeptide chain below: Alanine - Arginine - Valine - Histidine - Aspartic acid -…
A: Amino acids are organic molecules comprised of two functional groups that are an amino group and the…
Q: Which of the following amino acids is most unlikely to be present in a beta sheet? O Leucine O…
A: Beta sheet consist of beta stands connected by atleast 2 or 3 backbone hydrogen bond laterally which…
Q: Which of the following statements concerning the peptide NH3-Val-Ala-Gly-Lys-Leu-Gly-Val-Phe-…
A: The given peptide is as: NH4+-Val-Ala-Gly-Lys-Leu-Gly-Val-Phe-Tyr-Ile-COOH This polypeptide has 10…
Q: A protein with which of the following sequences may be more prone to undergo farnesylation? (a)…
A: Prenylation (or lipidation) is a process of "post-translational modification" (PTMs) of proteins by…
Q: Which of the following amino acids is not part of tetramer that is bounded to NAM and glycine?…
A: Peptidoglycan is the major component of bacterial cell wall. Gram positive bacteria have a thick…
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…
A: The primary structure of the protein refers to the amino acid sequence in the peptide. The amino…
Q: What does the "alpha" indicate in "α-helix"? It is a Greek helix. It's position lies above the…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. The linear…
Q: A helical wheel is a two-dimensional representation of a helix, a view along its central axis. Label…
A: In this question we are given a helical wheel in a two-dimensional representation. We have to…
Q: Protein synthesis in bacterial cells usually starts with a: phenylalanine residue. alanine…
A: Proteins have four levels of structural organization including Primary, secondary, tertiary,…
Q: At what level of protein structure (primary, secondary, tertiary, or quaternary) will protein…
A: There are various levels of protein structure- Primary structure of the proteins consists of its…
Q: Which of the following peptides will likely form an irregular structure? A-D-I-E-L-Y-F-H-I-C-V-D-E…
A: The key to perfect structure of peptides is amino acids Irregular peptide structure don't form…
Q: Which of the following is the C-terminal amino acid in the polypeptide…
A: In a polypeptide chain, the amino acid consist of an amino group on the alpha carbon atom at one end…
Q: Ile-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys-Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-…
A: Most common secondary are the α-helix and the β-pleated sheet. Both the secondary structure is…
Q: secondary structure? O -KPGHP- O-KRKKK- -YFVWT- O-MRLEK-
A: Beta sheets are secondary structures of a protein that are formed due to interchain hydrogen bonding…
Q: Which of the following peptides will likely adopt an alpha helix structure? (idk)…
A: α-helix is a secondary structure of protein in which the polypeptide chain twists to form a helical…
Q: The bottom peptide segment is found in the secondary structure composed of anti-parallel - sheets.…
A:
Q: Within a naturally-occurring polypeptide, under neutral pH conditions (pH = 7.0), which of the…
A: According to central dogma, the final synthesis in the body is from the RNA to protein. As the…
Q: The amino acid arginine ionizes according to the following scheme: NH, NH2 NH2 H NH, C=N C=N C=N…
A: All amino acids contain atleast two ionizable groups-alpha main and the carboxyl group. Some amino…
Q: What is the net charge at pH 7 on a peptide with the following sequence?…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: I-D-E-L-Y-S-Q-V-C-S-H-L-D-T-V-R This amino acid sequence forms an alpha helix. What side would face…
A: A protein is a long polypeptide chain of amino acids. It is usually formed by joining of amino acids…
Q: In your own words discuss the different structures (primary, secondary, tertiary, and Quaternary…
A: The folded structure of a protein has different levels of organization. These are primary,…
Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…
A: Answer :- Met-ala-phe-lys-stop DNA…
Q: Identify and encircle the peptide bonds in this polypeptide (Asp-Sec-Leu-Cys-Glu).
A: Amino acids are compounds that contain amino as well as carboxylic acid groups. These are the…
Q: Which of the following base change will result in the alteration of the net charge of the amino acid…
A: Proteins are composed of amino acids, which are joined together through peptide bonds. Proteins are…
Q: Given the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN…
A: The nucleic acids (DNA and RNA) are made up of nucleotides. The nucleotides are composed of…
Q: There is parts A-D for the picture provided. A) A peptide has the sequence,…
A: The pKa is the negative value of the logarithm of Ka. The pKa of the ionizable groups of an amino…
Q: In standard nomenclature, peptide sequences are read out in which direction? a) C to N b) 3’ to 5’…
A: A peptide is a compound consisting of two or more amino acids linked in a chain in which the…
Q: What is the net charge at pH 7 on a peptide with the following sequence? -1…
A: In biochemistry, pH can be referred as the decimal logarithmic value of the reciprocal of H+ ions…
Q: I-D-E-L-Y-S-Q-V-C-S-H-L-D-T-V-R This amino acid sequence forms an alpha helix. When thinking about…
A: A single polypeptide chain as given here, when folding into a tertiary protein molecule from a…
Q: Which of the following amino acids contains a carboxamide side chain? A.glutamine B.alanine…
A:
Q: A protein is made up for two polypeptides that differ in shape. Each polypeptide has one domain.…
A: The proteins have different levels of structure starting from primary to quaternary structure. The…
Which of the following peptides will likely adopt an alpha helix?
- H-I-R-E-F
- A-D-L-E-E
- A-D-E-L-E
- C-V-D-E-F
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following peptides will likely adopt an alpha helix structure? (idk) A-D-I-E-L-Y-F-H-I-C-V-D A-R-E-P-H-Y-D-P-C-Q-S A-D-I-E-L-Y-M-H-I-C-V-D A-R-E-V-H-Y-I-D-C-Q-FWhich of the following peptides will likely form an irregular structure? A-D-I-E-L-Y-F-H-I-C-V-D-E A-R-E-G-H-Y-D-G-C-Q-S-G A-R-E-V-H-Y-D-I-C-Q-S-F A-R-E-F-C-Y-D-I-C-Q-S-PDraw the structure of this peptide: N-Met-His-Tyr-Leu-Asp-Ser-Arg-Leu-C
- I-D-E-L-Y-S-Q-V-C-S-H-L-D-T-V-R The amino acid sequence above forms an alpha helix. Place the amino acids on the wheel given below. L1 represents Leu.Which of the following best describes how the secondary structure of a protein is formed? A B с D O=U a-helix H O=C N-H R-C-H C=0 H-N H-C-R O=C N-H R-C-H C=O H-N O-C N-H R-C-H C=O H-N N-H 0= H-C-R H-N C=O R-C-4 N-H O=C H-C-R 4-1 Ç=O R-C-H N-H 0=C H-C-R (=O R-C-H B-pleated sheet ionic bonds between the R groups of the polypeptide amino acids -Uh hydrogen bonds between the carboxyl and amino groups of non-adjacent amino acids covalent bonds between the carboxyl and amino groups of adjacent amino acids hydrogen bonds between the R groups of the polypeptide amino acidsFor the three peptides below, label whether they would form an amphiphilic beta-strand, amphiphilic helix, or nothing. Explain why. Part a) S-V-K-I-Q-M-R-A-D-L Part b) A-L-E-H-M-F-R-Y-L-A-K Part c) A-L-A-I-W-F-P-D-R-K-E
- The sequence of a peptide is given below. Ala-gly-val-leu-trp-lys-ser-phe-arg-proWhich peptide bond(s) are cleaved by chymotrypsin(A helical wheel is a two-dimensional representation of a helix, a view along its central axis. Label the blanks on the helical wheel diagram to show the distribution of amino acid residues in a helical segment with the sequence -Val-Asp-Arg-Val-Phe-Ser-Asn-Val-Cys-Thr-His-Leu-Lys–Thr-Leu-Gln-Asp-Lys- 1 Answer Bank H L D K R F T K S Tc=0 OH CH2 H CH2 H CH, H. H-Nt CH' CH N. CH CH CH' H CH CH3 H CH H CH2 CH, CH, CH2 CH2 CH3 CH2 CH2 * NH3
- Write the structure of each of the following peptides. Start with the N-terminal and the COO- on the right end. His-trp-cys Gly-leu-ser Arg-ile-val His-arg-lysAttempt 8 Consider the hypothetical serine protease in the image, which shows the specificity pockets. The S1 pocket has a glutamic acid in the bottom, the S2 pocket is small and R3 H. R1 hydrophobic, and the S1' pocket is deep and hydrophobic. Suggest a 3-amino acid sequence that this protease would cleave and indicate between which sites the peptide bond R would be broken. S2 Si Which sequence would this protease cleave? O Leu-Val-Arg Arg-Val-Leu Val-Leu-Arg Val-Arg-Leu Leu-Arg-Val Arg-Leu-Val W Ma tv 894Consider the following two peptides: I. N-Pro-Pro - Glu - Glu - Tyr - His - Cys - Ala - Glu - Gln - Lys - Leu - Ser - Ser - Phe-Leu- Thr - C II. N-Pro-Pro - Lys - Arg - Gly - Tyr - His - Gly - Glu - Asp - Glu - Asp - Glu - Ser - Gly-Phe- Tyr-C Give three reasons why_peptide I is more likely to form an alpha helix in aqueous solution at pH 7.0. Your reasons may include why_peptide Il is less likely to form an alpha helix