Answer the below questions based on the following peptide sequence: ...-H-R-R-D-K-D-E-K-P-G-P-G-A-Y-I-V-D-M-A-F-M–I-G-G-P-K-A-H-D-.. What is the secondary structure that is formed in the underlined portion? • What interactions stabilize the underlined sequence? Identify the atoms. What secondary structure is present surrounding the underlined sequence?

Q: The amino acid arginine has the following forms: H3Arg pK1=1.82 H2Arg* pK2=8.99 HArg pK3=12.1 Arg…

A: Amino acids Proteins are the polymers of nitrogenous compounds called amino acids. Each amino acid…

Q: Illustrate the titration curve of the peptide with the given sequence below. Show the pKas,…

A: The given peptide is composed of eight amino acids attached together via peptide bonds. All the…

Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…

A: Small molecules called amino acids form the building blocks of proteins. In chemistry, an amino acid…

Q: The β-sheet structure is the secondary structure of the protein which is a sideways folded structure…

A:

Q: A biochemist is designing a peptide that will form the most stable α-helix possible. He needs to…

A: The helix which has to be made must have a polar and non-polar surface and it should be highly…

Q: When answering the questions below, please use the one-letter code for the amino acid, with NO…

A: Acid hydrolysis: Acid hydrolysis of any protein/polypeptide is being used to detect amino acids…

Q: For the protein given in the attached picture: Write the name of these 5 amino acids corresponding…

A: Proteins are composed of amino acids attached together via peptide bonds. The linear structure of…

Q: A protein in its native three dimensional conformation is cleaved with trypsin. According to the…

A: The correct option should be B (The protein is highly compacted, minimally accessible by solvent…

Q: The sequence of a 29 aa long peptide can be determined from the following data: Treatment of the…

A: A peptide is an amino acid chain that is small in length. The amino acids in a peptide are linked…

Q: hymotrypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide…

A: Peptidases are enzymes that act on the peptide bond. Endopeptidases are enzymes that catalyze the…

Q: Instructions: Write the structure of the following peptides in a bond paper and upload as pdf file…

A: Amino acid is the smallest monomer of the protein, which are joined by the peptide bond.

Q: Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal…

A: Sequencing of proteins is done by treating Proteins with different enzymes that have specificity in…

Q: A protein with a known mass of 240 kDa is treated with -mercaptoethanol, a sulfhydryl reducing…

A: Proteins are polymers/chain of amino acids linked by peptide or amide bonds. It is called as primary…

Q: Consider the following pKa values: terminal amino group: 9.5; C = 8.2; Y = 10.1; K= 10.5; terminal…

A: Isoelectronic point is defined as the pH at which the amino acid does not move in an electric field.…

Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…

A: The primary structure of the protein refers to the amino acid sequence in the peptide. The amino…

Q: What does the "alpha" indicate in "α-helix"? It is a Greek helix. It's position lies above the…

A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. The linear…

Q: Which of the following peptides will likely form an irregular structure? A-D-I-E-L-Y-F-H-I-C-V-D-E…

A: The key to perfect structure of peptides is amino acids  Irregular peptide structure don't form…

Q: This diagram shows the allowed rotations about the backbone of a peptide: Sigmoidal Curve Homology…

A: The amide group (CO-NH) is referred as peptide peptide group and has a rigid planer structure. The…

Q: What is a zwitterion? Support answer with illustration  In naming an amino acid, how many indicate…

A: Zwitterion Zwitterions is hybrid of molecules contains positive and negative ionic group Each amino…

Q: Ile-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys-Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-…

A: Most common secondary are the α-helix and the β-pleated sheet. Both the secondary structure is…

Q: Calculate the pI of both peptides. Which is more acidic and why?

A: Given sequence, PEPTIDE #1: Pro-Phe-Thr-Cys PEPTIDE #2: Gly-Tyr-Ser-Asp If the peptide does not have…

Q: Discuss the different structures (primary, secondary, tertiary, and Quaternary structures) of…

A: Proteins are amino acid polymers. The sequence of amino acids determines their three-dimensional…

Q: Five amino acids were subjected to reverse phase chromatography, and the following Rf values were…

A: The normal phase chromatography has a polar stationary phase and a non-polar mobile phase. The…

Q: A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5'…

A: Introduction Amino acids are molecules that combine to form proteins, They build muscles, prevents…

Q: Which of the following peptides will likely adopt an alpha helix structure? (idk)…

A: α-helix is a secondary structure of protein in which the polypeptide chain twists to form a helical…

Q: The bottom peptide segment is found in the secondary structure composed of anti-parallel - sheets.…

A:

Q: You have isolated a protein and use size exclusion chromatography to estimate its molecular mass to…

A: Introduction Chromatography is a scientific technique for separating the components of a mixture.…

Q: The amino acid arginine ionizes according to the following scheme: NH, NH2 NH2 H NH, C=N C=N C=N…

A: All amino acids contain atleast two ionizable groups-alpha main and the carboxyl group. Some amino…

Q: In the figures are the titration curves of two amino acids. Consider the first titration. ☐☐☐ ☐☐☐…

A: PH is defined as the negative logarithm of H+ ion concentration (PH = -log [H+]). A titration curve…

Q: In your own words discuss the different structures (primary, secondary, tertiary, and Quaternary…

A: The folded structure of a protein has different levels of organization. These are primary,…

Q: Draw the structure of peptide with the following amino acids Gly-Leu-Ala-Gly-Pro-Hyp. The structure…

A: Amino acids are the basic unit of proteins. There are 20 amino acids that form peptides or protein.…

Q: When answering the questions below, please use the one-letter code for the amino acid, with NO…

A: Protein sequencing is the process of determination of amino acid sequence in a protein. During the…

Q: Oftentimes, the major challenge in the determination of protein structure via X-ray crystallography…

A: X-ray crystallography of a protein is used to obtain the three-dimensional structure of the…

Q: Classify each of the following amino acid as polar or nonpolar. If polar, indicate if the R group is…

A: Amino acids are organic compound made up of two functional group namely carboxyl and amino group.…

Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…

A: Answer :-                             Met-ala-phe-lys-stop                  DNA…

Q: Match the protein structure terms on the left with the descriptions on the right. v(Choose) commonly…

A: Proteins are the unbranched polymer of amino acids. There are four level of structural organization…

Q: A peptide with 12 amino acids has the composition (not sequence) Asp 2Cys 2Glu 2Leu 2Ser 2Tyr Val.…

A: Proteins are polypeptide sequences comprised of amino acids. Arrangement of amino acids in different…

Q: Peptide A: V-E-S-A-L-D-I-F-R-T-A-L-S Peptide B: S-E-P-P-T-E-G-P Peptide C: T-L-S-A-R-I-D-V…

A: Proteins structures are classified as Primary, Secondary, Tertiary, and Quaternary structures.…

Q: The peptide linkages are essentially planar O A. Primary Structure B. Secondary Structure O c.…

A:

Q: Do the following a. Complete the missing bases. b. Evaluate the chain and write the polypeptide…

A: DNA is a double stranded helical model composed of several nucleotide joined end to ends. A…

Q: There is parts A-D for the picture provided. A) A peptide has the sequence,…

A: The pKa is the negative value of the logarithm of Ka.  The pKa of the ionizable groups of an amino…

Q: What is the primary amino acid sequence of the peptide depicted? NOTE - Give your answer using…

A: Macromolecules are types of biomolecules that are needed in large amounts for the growth and…

Q: Using the Chou-Fasman rules (without calculating numerical probability) predict the secondary…

A: Chou fasman rules is a method to predict the secondary structural in polypeptide sequence.  It is…

Q: A peptide has the sequence Glu-His–Trp–Ser-Gly-Leu-Arg-Pro-Gly The pK, values for the peptide's side…

A: Amino acids have alpha amino and carboxyl groups that can be titrated. Some amino acids have side…

Q: The primary structure of proteins has polar and non-polar groups. Explain how these groups…

A: The primary structure is the long polypeptide chain which is composed of the amino acid monomer…

Q: A NONAPEPTIDE that attacks and kills cancer cells has just been recently isolated from a rare…

A: The peptides are formed by linking amino acids through peptide bonds between the carboxyl and the…

Q: When answering the questions below, please use the ONE-LETTER CODE for the amino acid, with NO…

A: Trypsin and chymotrypsin are the proteases that break down protein into individual amino…

Q: What is the PRIMARY STRUCTURE (amino acid sequence) of the peptide depicted below? NOTE - PROVIDE…

A: Proteins are polymeric molecules made of repeating amino acid monomers. There are 20 different types…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.