Which of the following is false?Every cell in the body makes every protein.14 101Each cell contains an exact copy of the DNADNA is translated into proteins by RNAEcessibility: Good to goOCells of different tissues produce different proteins.f5f6f7 [4]f8Whpf9f10f11(Ctrl) -84°Ff12

Name: Which of the following is false?Every cell in the body makes every pr
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Which of the following is false?Every cell in the body makes every protein.14 101Each cell contains an exact copy of the DNADNA is translated into proteins by RNAEcessibility: Good to goOCells of different tissues produce different proteins.f5f6f7 [

Introduction: All cells' primary operating molecules and structural constituents are proteins. All…

Science

Biology

Which of the following is false? Every cell in the body makes every protein. Each cell contains an exact copy of the DNA DNA is translated into proteins by RNA Cells of different tissues produce different proteins. (Ctrl)-

Which of the following is false? Every cell in the body makes every protein. Each cell contains an exact copy of the DNA DNA is translated into proteins by RNA Cells of different tissues produce different proteins. (Ctrl)-

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter17: Biotechnology And Genomics

Section: Chapter Questions

Problem 6RQ: Insulin produced by molecular cloning is of pig origin is a recombinant protein is made by the human...

See similar textbooks

Similar questions

The X's correspond to the missing information. You need to determine what those X's represent DNA STRAND: XXX-CCC-GGG-GCG-XXX-XXX-XXX-GCC-ATA-TTA-XXX RNA STRAND: XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX PROTEIN: Met - X - X-X - Thr - Val - Glu-X-X-X - Trp To be clear, your answer is just the 3 sequences above without the X's (the highlighted yellow parts). There may be more than 1 correct answer for some parts of this assignment. Any answer your choose is fine. If you are unclear on how there could be more than 1 correct answer, review the lecture related to protein translation. Provide me with the: 1. Complete DNA sequence of 33 nucleotides 2. Complete RNA sequence of 33 nucleotides 3. 11 amino acids
ABO blood group system is defined by the presence of agglutinogens (A and B molecules) at the surface of red blood cells. Enzyme A which leas to the production of the molecule A is coded by all ele A, while enzyme B which leads to the production of the molecule B is coded by allele B, and enzyme O which cannot lead to the production of any molecule is coded by allele O. A part of the coding DNA strand for enzyme A: GAC GTG CGC GCC A part of the coding DNA strand for enzyme B: GAG GTG GcC GCC 5. Compare the non-transcribed strand coding for enzyme A to that coding for enzyme B. 6. Identify the type of mutation involved in this case. Justify. 7. Write the amino acid sequence for both enzymes. 8. "Mutations can lead to diseases or to genetic diversity"Justify by refering to parts A and B. Second letter A G UCU UCC UCA UUG Leu ucG UUU T Phe UUC UAU1- Tyr UACJ Ser UAA Stop UGA Stop UGU), UGCJ UUA UAG Stop UGG Trp CAUTHIS CCU CC CCA CCG CUU CÚC CÁCJ Pro CAA CGU] CGC Arg FLeu CGA CGG CỦA Gln…
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Arial BIUA 11 + .. | I 1 I 3 I 4 i.) Fill in the table for each of the E. coli: (0) = No Activity (+) = Basal Activity and (+++) = High Activity E. coli chromosome F' Plasmid B-gal activity? Permease activity? When When When When Glucose is Lactose is Glucose is Lactose is present present present present a.) I+ P+ O+ Z+ Y+ Inone +++ +++ b.) I^[S] P+ O+ Z+ Y+ none c.) I+ P+ O^[c] Z+ Y+ none d.) I+ P+ O- Z- Y+ none e.) I+ P+ O+ Z+ Y+ I^[S] P+ O+ Z+ Y+ f.) I^[S] P+ O+ Z- Y+ I+ P+ O^[c] Z+ Y- g.) I^[TB] P+ O+ Z+ Y 1+ P+ O^[c] Z- Y+ h.) I+ P+ O^[c] Z+ Y- I+ P+ O+ Z** Y+ i.) I^[TB] P+ O^[c] Z+ Y- 1+ P+ O+ Z- Y+ Z** is a polar mutation ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of ß-galactosidase protein activity with and without lactose present, why? MacBook Air 000
Please ASAP. Thank you. Bodi had his DNA tested using some of the CODIS primers. His results have been analyzed and are listed below, with the calculated frequencies of having each genotype separately. Locus name Bodi's genotype Frequency of that genotype TPOX 8,8 0.0352 D5S818 11,13 0.13 D3S1358 15, 18 0.082 D16S539 11,11 0.095 What is the probability that any human on Earth would have this exact combination of genotypes? Show your work and give your answer in scientific notation.
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Which of the following things must happen first if DNA is going to be replicated * DNA gets broken into smaller pieces to make the process more manageable DNA gets unzipped, so the two complimentary strands are separated DNA Polymerase adds on bases that match with the original strand DNA gets wound back into chromosomes so it's ready for mitosis Lenovo esc -> 女 # 2$ 2 3 5 6 7 8 9. tab e r t y a f k ift V alt ctri
Daichi Yamada, 65 years old, immigrated to California to live with his son after the Fukushima tsunami and nuclear power plant disaster destroyed his community in 2011. Recently he began complaining of fatigue, left-side pain, abdominal fullness, and night sweats. His son scheduled a check-up for him, and a routine blood screening test showed elevated basophils and eosinophils. Bone marrow tests showed the Philadelphia chromosome by fluorescence in situ hybridization (FISH), confirming rearrangement between chromosomes 9 and 22, which occurs in 95% of cases of chronic myelogenous leukemia (CML). He also had an enlarged spleen and liver. A diagnosis of CML was made and treatment with the tyrosine kinase inhibitor imatinib mesylate (Gleevec) began. Over the next 4–8 weeks Daichi’s bone marrow showed regrowth of normal stem-cell populations, and stable white blood cell proportions were restored. Which of the following genes are associated with the chromosomal translocation in CML? a.…