Which of the following are possible responses to a membrane receptor being activated? O activating enzymes that increase rates of a chemical reaction (metabolism a molecule, for example) leaving the membrane to enter the cytoplasm O activating enzymes that then activate transcription factors O initiating a signaling cascade that opens an ion channel
Q: Which of the following is true about cell potential? a. It is the sum of the oxidation and reduction…
A: The oxidation-reduction reaction is also called the Redox reaction. This reaction involves…
Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…
A: Given P1(Parent 1)= Round Shape(T) Yellow Colour (Y) P2(Parent 2)= Wrinkled Shape(t) Green Colour…
Q: When specific conditions are met, the creation of peptide bonds rather than the hydrolysis of…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: What is the dna strand sequence for phosphate sugar backbone?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Promote platelet aggregation and smooth muscle contraction…
A: PGH2 : Prostaglandin H2 TxB2 - Thromboxane B2
Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…
A: Okazaki fragments are short stretches of DNA on the lagging strand, which is synthesized in the…
Q: well-conserved regions in multiple sequence aligmements: a. are areas of structural importance b.…
A: Multiple Sequence Alignment (MSA) is the alignment of three or more comparable length biological…
Q: Question 24 CH,-0-C-(CH,)14–CH, CH-0-C-(CH,)16-CH, CH3 сH, —о—р—о—сH, — сн, — N—сH, CH, What is the…
A: Depending on the strut of lipid ,they are classified as simple and complex lipid. Simple lipids are…
Q: If the extracellular K* concentration increases to 20 mM, what would be the Nernst Potential of K*…
A: Membrane potential is the voltage difference between inside to outside of the cell. In absence of…
Q: Fat storing cells of vertebrates are called hеpatocytes - asterocytes - adipocytes melanocytes
A: Lipids are easily soluble in nonpolar solvents such as benzene, ether, and…
Q: In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form gluconolactone.…
A: A glucometer is generally a little, portable device that helps to monitor (glucose levels) at home.…
Q: 8/9 Instructions; • Answer the Question properly and accordingly. • Do not copy here in Bartleby or…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Illustrate and summarize ketogenesis.
A: Ketogenesis is one of the biochemical pathways. The process of ketogenesis occurs in the liver. The…
Q: 3. In what direction (toward the anode, toward the cathode, or toward neither) will the following…
A: As like amino acids, peptides, and proteins include both acidic and basic functional groups. The…
Q: When mixes with benedict's solution test tube A 4 amylase and starch will have what color and why
A: Amylase is an enzyme that helps to digest food. Most of our amylase is made in the pancreas and…
Q: ng glycolysis, t
A: Disclaimer: “Since you have asked multiple question, we will solve the first question for you. If…
Q: Which of the following condition is NOT associated with riboflavin deficiency? * (Please choose one…
A: Riboflavin is a water soluble vitamin. It is also called as B2 vitamin. Foods like pork, eggs,…
Q: 5. Regulation of bacterial operons by inducers, e.g. lactose, exhibits which of the following…
A: The regulation of gene expression can occur at the level of transcription and translation.
Q: Which of the below statements is correct regarding tertiary structure? All are correct Disulfide…
A: A protein has four structural levels of organization – primary, secondary, tertiary and quaternary…
Q: Which of the following is a property of an enzyme? * (Please choose one correct answer only)…
A: Enzymes are the biological catalysts that mediate biochemical reactions by decreasing their…
Q: Competitive inhibitors are: Select one: O a. bind to another part b. causing the enzyme t bind to…
A: Inhibitors are molecules that bind to enzyme and block it's activity. Enzymes inhibitors are…
Q: a. list the proteins in the order of first to the last that eluted 6. list the proteins in the order…
A: Proteins are composed of amino acids with specific molecular weight and pI (isoelectric point).…
Q: . What mRNA base sequence would be obtained from the following portion of a gene?
A: Genetic information is transferred from genes to the proteins via messenger RNA.…
Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…
A: Cells are composed of different components, cell organelles and molecules that are responsible for…
Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…
A: In general, qPCR is beneficial for determining the actual value of a PCR product present at a given…
Q: Explain the biochemical consequences of Glucose-6-Phosphatase deficiency that results in gout due to…
A: The enzyme glucose-6-phosphatase regulates the release of glucose from glycogen stored in the liver.…
Q: 10. Messenger RNA often encodes more that one biological activity. These activities can then be…
A: Introduction: Messenger RNA (mRNA) is a single-stranded RNA that carries hereditary information from…
Q: The free energy of folding of a protein is -17kJ/mol. What tenoerature (C) do you have to heat the…
A: Protein folding is related to protein stability that is the thermodynamic stability, not the…
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: Introduction: In retrovirus, RNA is used as genetic material. It uses the enzyme…
Q: IV. Test Tube Effect of Enzyme concentration Concentration of Observations enzymes (mL) I 2 3
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Given Raffinose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Raffinose is a trisaccharide of glucose, galactose and fructose in which glucose acts as a bridge…
Q: TIONS (Continued)
A: 5) Hydrololysis is a reaction in which reactant react with water and decomposition of water and…
Q: Match the following: choices: transcription factor
A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…
Q: Describe the ion dynamics of the muscle-contraction process.
A: Tension-generating regions within muscle cells are activated during muscular contraction. Muscular…
Q: All are members of the electron transport chain, except: Select one: O a. iron-sulfur center O b.…
A: The components of the Electron Transport Chain (ETC) are found in the mitochondria. During…
Q: Paracelsus is famous for saying that “all substances are poisons; there is none which is not a…
A: Poisons are chemicals that have the potential to kill. They are chemicals, either man-made or…
Q: C17H29COOH linolenic acid non-saponifiable ω-3 fatty acid All are correct
A: Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain…
Q: I want a solution that is 1/10th the strength of my stock solution. I want 20 microliters of total…
A: A solution can be diluted to the desired concentration by using the formula C1V1=C2V2 Where C1=…
Q: A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBr) and into two different…
A: The given peptide sequences are: CNBr 1: Gly-Thr-Lys-Ala-Glu CNBr 2: Ser-Met Tryp 1:…
Q: What are examples of enzymes?
A: Enzymes are nothing but Proteins that help us in our metabolic pathways to increase the rate of…
Q: -Inhibitor +Inhibitor [S] (mM) V0&νβσπ; (μmol/sec). V0&νβσπ:&νβ σπ: (μmollsec) 0.0001 33 17 0.0005…
A: Km of an enzyme is the substrate concentration at half Vmax. It can be calculated from lb plot by…
Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Tagatose is ketohexose i.e. it has 6 carbons and is a ketose sugar.
Q: Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is…
A: Restriction digestion is a process in which DNA is cut into smaller pieces at specific sites with…
Q: Which of the following glycosidic linkages is hydrolyzed by the α-amylase? α(1,6) α(1,4)…
A: The monosaccharide units of oligosaccharides and polysaccharides are linked together through the…
Q: Explain the enzymes.
A: Enzyme, a molecule that works as a catalyst in living organisms, regulating the pace at which…
Q: 20. Beta-oxidation of fatty acids takes place at A. peroxisome B. mitochondria C. mitochondria and…
A: Beta oxidation of fatty acid - Process via which the fatty acids get broken down for energy…
Q: Suggest, which enzyme pathway come into play
A: Phenylalanine is an aromatic and non-polar amino acid, it is both glucogenic (Fumarate) and…
Q: Using the concept of complementary base pairing, write the complementary DNA strands, with their 5'…
A: The DNA molecule generally has two strands that wind around one another to form a shape is generally…
Q: 5. Amino acid methionine is used as medicine due to its lipotropic ellect («removes» fat excess from…
A: The orange structure is the liver The red arrows indicate the transport is happening via the blood…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Step by step
Solved in 3 steps
- The synaptosome-associated receptors referred to as v-SNARES are transmembrane proteins located on which of the following eukaryotic cell structures? mitochondrial membranes chloroplast membranes vesicle membranes lysosomal membranes peroxisomal membranesWhich type of receptor alters the cytoskeleton when a ligand binds to it? Integrin receptor G protein-coupled receptor (GPCR) O Receptor-enzyme O Receptor-channel Submit Previous Answers Request Answer X Incorrect; Try Again; One attempt remaining This either opens or closes a channel, or alters intracellular enzyme activity in response to ligand binding.Which of the following mechanism will be activated if there is a shortage of cellular and endoplasmic reticulum Ca2+ reserve? O DAG will activate protein kinase C to release calcium bound to calmodulin ER membrane protein STIM1 will activate plasma membrane Orail channel All of the other mechanisms will be activated IP3 signaling will release stored calcium from the ER DAG will activate protein kinase C to activate store operated calcium channel in the plasma membrane < Previous Next ▸
- Cytokine receptors and tyrosine kinase receptors are similar in all of the following ways EXCEPT one. Which one is the exception? O They are both down-regulated by lysosomal degradation They both involve receptor exoplasmic domain dimerization They both result in an effector protein entering the nucleus O They both involve cytosolic domain phosphorylationUsmotic Which of the following is associated with intracellular nuclear receptors? O Transcription factors Signal transduction Transcription factors and signal transduction O O None of the above Back Next Clear formReceptors often activate signaling molecules that are __________. This property helps to increase signaling efficiency of this pathway. bound to the plasma membrane floating in the cytosol locked in the endoplasmic reticulum inside the mitochondria all of the above
- Which of the following utilizes receptors that are located in the cytosol? Steroid Hormone Signaling GPCR Singaling Ion channel signaling RTK SingalingYou perform a competition study on a GPCR. You have isolated the plasma membrane from cells which contains the GPCR of interest. If an agonist and an inverse agonist are at equal concentrations in your study but the inverse agonist has a 10 x higher affinity for the receptor than the agonist, what would you expect to be the overall outcome to be? More of the agonist is bound and so most of the receptor is in its active conformation and is stimulated More of the inverse agonist is bound and so most of the receptor is in its inactive conformation and is unstimulated.Non-canonical Hedgehog signaling results in actin cytoskeleton rearrangements, leading to cellmovement and changes in cell shape. Describe how changes to the actin cytoskeleton lead to cellmovement and changes in cell shape.You do not need to draw out the signaling pathway again (#1b). Your answer should focus onthe changes to the actin cytoskeleton. Drawings will be helpful!
- Gap junctions and tunneling nanotubes are two distinct types of direct intracellular communication. In comparing and contrasting gap junctions and tunneling nanotubes, which of the following statements is true? gap junctions provide a portal for small molecules, proteins and small organelles to move from cell to cell, tunneling nanotubes only permit small molecules to pass between cells typically, there are only two gap junctions that exist between adjacent cells that are communicating via this mechanism; on the other hand, there are many tunneling nanotubes between communicating cells both gap junctions and tunneling nanotubes can pass small molecules between cells none of the above is trueWhat term is used to indicate signaling chemicals that bind to membrane receptors? Which type of membrane receptor is most important in directing intracellular events by promoting formation of second messengers?cell communication through plasma membrane What are the 4 types-of receptors and their downstream pathways. Draw a quick sketch of each step with a quick description