20. Beta-oxidation of fatty acids takes place at A. peroxisome B. mitochondria C. mitochondria and peroxisome D. mitochondria, peroxisome and ER
Q: All the dehydrogenases of glycolysis and the citric acid cycle use NAD+ (E°' for NAD+/NADH is -0.32 ...
A: NADH/FADH2 are also known as reducing equivalents. These reducing equivalents are produced in the gl...
Q: What are the other methods of detection for blood glucose determination? Explain the principle invol...
A: There are different methods for estimating the levels of glucose in the blood. The different methods...
Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl cyclas...
A: All the mentioned components are involved in signal transduction.
Q: 13. Which of the following is an example for derived lipids? A. steroids B. terpenes C. carotenoids ...
A: Hi! Since you have posted multiple question, we shall answer the first question for as we are only ...
Q: What is not an example of a reactive oxygen species (ROS)? 1. superoxide 2. hydroxyl radical...
A: Introduction: Reactive oxygen species are also referred to as free oxygen radicals. It is a highly r...
Q: What is the AG for the following reactions: ATP + H20 → ADP + P. AG= ADP + P → ATP + H20 AG =
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the firs...
Q: Based on the figure and the explanation in the textbook, what are the random chances that the di-sul...
A: Denaturation is the process by which proteins lose their native conformation. Ribonuclease A has 124...
Q: 2. The kinetic effect of purely competitive inhibitor of an enzyme: (A) Increases K without affectin...
A: Hi. Thank you for the question. As per the honor code, we are allowed to answer three sub-parts at a...
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial...
A: Vmax is the reaction's maximum speed at which all of the enzymes become saturated with the substrate...
Q: 3. The trp repressor is a homodimer with 107 amino acid residues per monomer. The content of proton ...
A: As content of proton dissociable group presented in table, here we can count the charge status of di...
Q: ssume that you have radioactively labeled an amino acid in a glass of milk. Also assume that you hav...
A: Introduction: The term digestion refers to the integration of complex nutrients into simple, soluble...
Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Propose a reasonable pathway to degrade the following amino acid to core metabolic intermediates. Me...
A: In the given amino acid structure, there is additional amino group in sidechain and structure is sim...
Q: Describe the basic features of the DNA double helix
A: DNA is Deoxyribo Nucleic acid . This is the biomolecule that is responsible for heredity in almost a...
Q: Using G-25 Sephadex beads (Fractionation range 1000-5000) KD, a sample of Vitamin B12 (MW ~1500 KD) ...
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since yo...
Q: What is the flow of genetic information?
A: Introduction: The first direct evidence showing that the genetic material is DNA rather than RNA or...
Q: In SDS page, the ________ proteins will move through the gel fastest and first, and in size exclusio...
A: SDS-PAGE is biochemistry technique used to separate proteins based upon the relative mobility of cha...
Q: Explain the principle involved in blood typing.
A: The most significant blood typing is based on ABO groups, though 20 different blood groups are known...
Q: You have a mixture of positive, negative and neutral proteins. In order to obtain a pure positively ...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Given the following protein: N-MACHKGFDSTRRKYWQNKRLCVSA|IDWQSPWKNQGILV-C The overall charge of this ...
A: (1)The ionizable groups in the given peptide at pH 7 are; N-terminal : it will have +1 charge Side...
Q: 2. The kinetic effect of purely competitive inhibitor of an enzyme: (A) Increases K, without affecti...
A: Hi. Thank you for the question. As per the honor code, we are allowed to answer three sub-parts at a...
Q: Arachidonic acids * A. Linoleic polyunsaturated omega-6 fatty acid is its starting material. B. Sp...
A: Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain of ...
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...
A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...
Q: Which of the following saccharides is INCORRECTLY described? * A. D-mannose: Monosaccharide: P...
A: Carbohydrates are macronutrients that the body requires for energy production. Carbohydrates provide...
Q: Enzymes increase the rate of a chemical reaction by providing an alternative path with a lower activ...
A: TRUE
Q: Among these amino acid combinations listed above, only the combination of Lys and Glu have side chai...
A: The tertiary structure of proteins are stabilized by non covalent interactions like hydrogen bonding...
Q: 1. Why is it important in Quantitative Analysis to postpone rounding until the calculation is comple...
A: A quantitative analysis is performed to detect the amount of specific substance in a sample solution...
Q: Protein solubility
A: here they are talking about protein solubility. Protein solubility is a thermodynamic property defin...
Q: Which of the following is INCORRECTLY paired? O Isoelectric focusing : Charge O Gel filtration chrom...
A: 1. Isoelectric focusing IEF is an electrophoretic method for separating proteins based on their isoe...
Q: Some mice have a mutation in the liver isozyme of pyruvate kinase leading to an inability to be phos...
A: Pyruvatw kinase in an enzyme which is involved in the glycolysis process. In Glycolysis, the cycle A...
Q: How many H2O particles were produced by creating the following structure? * R H R R H-N-C,-c- -N-C,-...
A: Amino acids are monomers of protein they are linked with each other by forming peptide...
Q: Are there any research involving white vinegar that it is effective as an ingredient in making insec...
A: Acetic acid is one of the most fundamental organic acids. In this context, "organic" refers to a che...
Q: Below are the structures of three phosphate-containing molecules. Which one has the lowest Phosphory...
A: Phosphate group is containing one phosphate group atom attached to four oxygen molecule.Various mole...
Q: What are the different mechanism of disease production?
A: The disease production mechanism identifies the likely source or causes of a problem/disorder, as we...
Q: 1.The 22nd amino acids and the only amino acid * A. Selenocysteine B. Selenicysteine C. Carbocystei...
A: Since you have asked multiple questions, we will solve only first question for you. If you want any ...
Q: a reasonable biosynthesis for Compound 14 starting from Propose alanine, S-phenylalanine and ATP.
A: Given compound in a figure is Aspartame. It is an artificial sweetener and is made by dipeptide of a...
Q: What is the process and principle behind isoelectric precipitation?
A: Isoelectric precipitation is a type of isoelectric precipitation that occurs when: The pH of a solut...
Q: What characteristic makes each amino acid unique from one another?
A: Amino acids are organic compounds with functional group namely carboxyl and amino. There are 20 amin...
Q: Do we need to denature proteins? Why?
A: Heating, pH fluctuations, high concentrations of chemicals like urea, or reducing agents that break ...
Q: Enumerate the main structural features of nucleosides and nucleotides
A: There are 4 biomacromolecules; protein, carbohydrate, lipid and nucleic acids. In these, nucleic aci...
Q: Explain structural differences between an acidic amino acid and a basic amino acid. How does structu...
A:
Q: 6 Concanavalin (ConA) is a 25.5KDa protein with pI of 4.7 and optical absorbance (A 0.1% 289) of 1.1...
A: Proteins are polymers of amino acids with specific molecular weight and pI (isoelectric point, pH at...
Q: Q24. Choose the best answer for the following questions.
A: Amino acids are building blocks of proteins and also important as a precursor for the biosynthesis o...
Q: 1.Classify each protein as fibrous or globular. A. hemoglobin B. keratin C. myoglobin
A: Proteins are classified into two categories, on basis of shape and solubility. 1. FIBROUS PROTEINS...
Q: Which of the following factors favors the formation of the Random DNA Coil? a Enthalpy b Bas...
A: Some parts of the protein chain do not form regular secondary structure or have a consistent hydroge...
Q: Directionality of Polynucleotide chains originates at the ____ end, and terminates at the _____ en...
A:
Q: Discuss about enzymes: function, definition, and examples.
A: At high temperatures, most of the enzymes denature and unfold similarly low temperatures als...
Q: electrical conductivity
A: Here they are talking about electrical conductivity. The counterpart of electrical resistivity is el...
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...
A: Glucose is converted to pyruvate through the process of glycolysis in the cytoplasm. The process of ...
Q: Kinesin-1 was the first member of the kinesin superfamily to be identified and therefore is perhaps ...
A: Kinesin are one of the mejor cytoplasmic motors responsible for long range transport in all eukaryot...
Step by step
Solved in 3 steps
- Dietary fats are transported as _____. Select one: a. lipid globules b. liposomes c. chylomicrons d. oil dropletsWhich of the following is NOT a fat soluble vitammin? ve O C O A O ELipids are transported from the intestine to the liver by (a) chylomicrons (b) HDLs (c) LDLs (d) glycerol transporters (e) leptin
- explain the structure and fucntion of the cell membraneand the role of lipids in the human body, include the function of proteins34. Which fatty acidis most likely to bea solid at room temperature? a. CH он b. CH, CH OH CH,-C-OH C. CH, CH=CH CH CH, CH=CH, CH d. CH, CH CH CH -C-OH20) The diagram represents an amino aciid. HOH Rrepresents a vanatleside chain. Winch is not a passiule salechant Crt: CH CHSCH CH CONH HOCH CHOICHO
- Which lipids are selectively enriched on the outer leaflet of the plasma membrane in a healthy cell? O glycolipids and PS O Pl and cholesterol sphingomylein and cholesterol O glycolipids and PC O PS and PCWhich of these are not embedded in the lipid .40 ?bilayer at all * integral proteins O glycoproteins transmembrane proteins peripheral proteins O9. Which of the following is a compound lipid?| ApoE Аров Аров ApoA ApoC Аров O lipoprotein inacar Ruie P han Cattyn Fre on Pap Cnoplaam glycolipid
- The specialized functions associated with the cristae can be attributed to O^the proteins and lipids in the membrane ОВ. the lipids in the membrane С. the proteins in the membrane D. "There is not enough information to answer.Why are lipoproteins needed to transport lipids in the bloodstream? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help nonpolar Most lipids are this property causes lipids to be in the bloodstream water-soluble Lipoproteins form complexes for transport through the bloodstream by surrounding polar lipids with phospholipids and proteins. water-insolubleA suspension of which of the following is most likely to form a liposome? i. Fatty acids ii. Triacylglycerols iii. iv. Sphingomyelins Glycerophospholipids iii & iv O ii & iv O ii & iii O i & ii Oi & iv