What are the nucleotides of the mRNA from gene Z? (see the attached picture) 5. The following is a DNA sequence of gene Z. The underlined sequence representsthe promoter for gene Z and the underlined and italicized sequence encodes thegene Z ribosome binding (RBS) site. Transcription begins at and includes the T/Abase pair at position 60 (bold)110203010506070I--------------I--I--I-I--------------5' ATCGGTCTCGGCTACTACATAAACGCGCGCATATATCSGATATCTAGCTAGCTATOGGTCTAGGCTACTAC3' TAGCCAGAGCCGATGATGTATTTGCGCGCSTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATGPromoter8090100110120130140I----I---------I------.-I---------I---CAGGTATCGGTCTGATCTAGCTAGCTTCTCTICTCICTCTCCCCCGCGGGGGCTGTACTATCATGCGTCG3' GTCCATAGCCAGACTAGATOGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGCRBS170-I-150160180190200210--I--I--------I--I--I---------ITCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGICTCGGCTACTACGTAAA3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT220230240250I------I--I-------5' CCCTATTAGCATGGGTCATATITGTGTCTGCTTGTTGGGT3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA

Transcription is the process of synthesis of mRNA from DNA. The DNA strand which acts as the…

Answered: What are the nucleotides of the mRNA…

Science

Biochemistry

What are the nucleotides of the mRNA from gene Z? (see the attached picture)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Related questions

Q: INTRUCTIONS: - Do not copy here in BARTLEBY or GOOGLE - PLEASE ANSWER PROPERLY Failed to follow inst...

A: Soaps are made up of different kinds of fats or oils. In an experimental setup, soaps are made up of...

Q: What are the important considerations that you have to remember in antibody screening?

A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...

Q: To which class does each enzyme belong? Explain hexokinase alanine aminotransferase alcohol deh...

A: The enzymes are divided into 7 classes mainly oxidoreductases, transferases, hydrolases, ligases, ly...

Q: 1. Draw the tetrapeptide Met-Ala-Thr-Thr at a ph of 7? 2. Draw the tetrapeptide Met-Ala-Thr-Thr at...

A: The pKa values of amino acid side chains determines the pH-dependent net charge of an amino acid in ...

Q: Why might it be necessary to include the 50 mL cultures in order to express protein? This question ...

A: Hi, First I would like to thank for submitting the question. The question has one error as the word ...

Q: Which of the following affects the rate of enzyme driven reaction? rate constant air pressure conce...

A: Enzymes: Enzymes are biocatalysts that fasten the rate of a chemical reaction. It is proteinaceous ...

Q: Explain the importance of adding TE Buffer as the final solution to isolate the concentrated DNA.

A: DNA isolation is a process of extracting nuclear material from a tissue sample. The tissue sample is...

Q: You have obtained experimental kinetic data for two versions of the same enzyme, a wild‑type and a m...

A: Michaelis-Mention constant (Km) or equilibrium constant for the dissociation of the E-S complex is e...

Q: Even under isotonic conditions, there is a slow leakage of ions into animal cells. How does the plas...

A: Osmosis is biochemical process by which water moves from a less concentrated solution to more concen...

Q: H. Draw a plot showing reaction velocity as a function of substrate concentration for Ks = 50 µM, Vm...

A: As here given in the question, Vmax= 5uM S-1 Ks=50uM and Ki = 250uM both in presence and absence of ...

Q: What is population? Describe its different characteristics with suitable examples

A: Population is a term used for addressing individuals of a species that coexist in a particular habi...

Q: 1. What are the main biological functions of polysaccharides?

A: A carbohydrate is a polysaccharide. It's a polymer made up of monosaccharide chains linked together ...

Q: What is the relative activity of the two structures shown below on the opioid receptor? HO HO. O A i...

A: Opioids are group of morphine- like chemicals medically used as anesthesia and as pain relief. The s...

Q: Using the chart below, can you produce a two-step procedure that demonstrates protein purification i...

A: Proteins are polymers of amino acids linked by peptide or amide bonds. Charge on the protein depends...

Q: I. Classify the following pairs according to their specific type of isomerism. Write your answer on ...

A: There are mainly two types of isomerism, structural isomerism, in which bonds between the atoms diff...

Q: hornhate Jusing phe pho

A: Every biochemical pathway is regulated by a particular enzyme. The nature of the enzyme determines t...

Q: Topic: Isolation of Crude Ovalbumin from Egg White by Ammonium Sulfate Precipitation (Salting Out) ...

A: Ovalbumin is an egg white protein which is responsible for egg white formation and has a molecular w...

Q: Which of the following is the major source of electrons that flow through the mitochondrial electron...

A: Cellular respiration refers to a process by which energy is obtained for various life processes taki...

Q: xplain what is meant by Optimum pH. Does pH lower than optimum pH denature the enzyme? How about pH ...

A: Enzymes are biocatalysts that fasten the rate of chemical reactions. It decreases the activation ene...

Q: Understanding: How are prokaryotes and eukaryotes similar? * O The both have nuclei. O They both hav...

A: 1.

Q: How are inhibiting agents different from those that denature an enzyme? Use the paperclip button bel...

A: Enzymes are proteins which increase the rate of biochemical reactions. All proteins become active on...

Q: Does Your PDB code: 3GRS have a quaternary structure? YES OR NO? https://www.rcsb.org

A: 3GRS is Glutathione Reductase which is an oxidoreductase (flavoenzyme).

Q: 9. What is the structure and functions of the carbohydrates

A: Biomolecules refer to a carbon-based organic compound that is produced by a living organism. These c...

Q: Remembering: CO2 in our body is transported through the blood primarily as O co2 myoglobin complex O...

A: Introduction: The waste product of aerobic respiration is carbon dioxide. Very high or low amounts o...

Q: (1) Which statement about glycolysis is FALSE?

A: "Since you have asked multiple question, we will solve the first question for you. If you want any s...

Q: Who is the father of biochemistry?

A: Biochemistry means the study of biomolecules presents inside biological organisms. It can also be de...

Q: QUESTION 16 Protein maturation in the ER includes. OA Disuifide bend formation Li proteolytic cleava...

A: Protein processing and modification occur in endoplasmic reticulum which has two sub units. Rough en...

Q: What structure is common to virus, prokaryotes and eukaryote? What are their major structural differ...

A: Viruses are the entities that are made up of Proteins encapsulating nucleic acid either DNA or RNA. ...

Q: 7. RNA molecule cannot have secondary structure. DNA double-stranded form is maintained by hydrogen ...

A: The DNA and RNA molecular structures have particular conformation and bonding. Both the structures a...

Q: The molecule glutaraldehyde is properly described as : a five carbon chain with a ketone group...

A: Glutaraldehyde, C5H8O2, is a dialdehyde comprised of pentane with aldehyde functions as C1 and C5 po...

Q: The nuclear import of proteins larger than 40 kDa requires the presence of what amino acid sequence?...

A: The nuclear envelop of all eukaryotes is perforated by a large structure known as the nuclear pore c...

Q: What is immunology? and what are the 4 types of immunity?

A: Any foreign substance which enters into the body is known as an antigen. Antibodies are proteins pro...

Q: The comparative form of far is more far

A: This statement given is not correct grammatically. There are three forms of comparison that we use i...

Q: ...::: What if there is too much amino acids in your body, what will happen to your body?

A: If there are many too many amino acids present in the body then there are serious harmful effects of...

Q: 1G. Please help me in detail. For Molecular Mechanism of ATP versus GTP selectivity of adenylate kin...

A: Specificity is an enzyme attribute that specifies how limited the enzyme's substrate selection is; a...

Q: Draw the tetrapeptide Met-Ile-Lys-Glu at a ph of 12?

A: The pKa values of amino acid side chains play an important role in determining the pH-dependent char...

Q: 1. in cherry crandall method for lipase analysis what is the substrate used?

A: As you have asked multiple questions, we would solve first question for you. If you specific questio...

Q: (Glucose), Fructose and Sucrose gave a positive result to Seliwanoff’s Test Beeswax when dehydrated ...

A: Introduction: Seliwanoff's reagent contains resorcinol and concentrated hydrochloric acid. The test ...

Q: What hormone directly opposes the actions ofnatriuretic hormones?a. reninb. nitric oxidec. dopamined...

A: Natriuretic hormones (NH) are compounds that act in an endocrine or paracrine fashion to modify extr...

Q: Calculate the pI value of aspartate. (iii) Calculate the pI value of arginine.

A: Amino acids are monomers that make proteins. The amino acids have a central carbon to which a variab...

Q: IV. Write on the first column the monosaccharide unit(s) that is present in the given disaccharide. ...

A: Carbohydrates, abbreviated as carbohydrates, are sugar molecules. Saccharides are another name for s...

Q: O a person who makes fun of people who train by imitating them O a drug that can cause the effects o...

A: Exercise is generally considered as a physical activity in which mostly the skeletal muscles under g...

Q: 1.) What are the main structural features of the polysaccharides starch? 2.) How do this aids in its...

A: Polysaccharides are major classes of biomolecules. Polysaccharides are long chain of carbohydrate mo...

Q: 4. a. Give the full names of the amino acids in this peptide. H3 N -CH-C-N-CH-C-N-CH- C ČH3 н Cнон н...

A: The pKa values of amino acid side chains that constitute a protein play an important role in determi...

Q: List 2 proteins that facilitate protein folding and briefly describe the role each play in the lifet...

Q: What mechanism of antibiotic resistance does the NDM gene code for?

A: Antibiotic Resistance is the phenomenon by which any bacteria can survive in the presence of Antibio...

Q: The following compound was obtained from cells, after supplying them with 1"C-labeled pyruvate. The ...

A: Pyruvate is a three-carbon compound that enters the TCA cycle through the pyruvate dehydrogenase rea...

Q: Consider the biochemical pathway below, where A, B, and C are substrates and products and E1 and E2 ...

A: Enzymes are proteinaceous in nature. Almost all enzymes are proteins, there are some nucleic acids t...

Q: 1. The molecule below is a pentose. C/OH H- HO- НО -H НО C/OH

A: As you have asked multiple questions we are supposed to answer only first question for you. If you w...

Q: Please give the color of each analysis indicating positive result and substance formed causing the c...

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...

Question

What are the nucleotides of the mRNA from gene Z? (see the attached picture)

5. The following is a DNA sequence of gene Z. The underlined sequence represents
the promoter for gene Z and the underlined and italicized sequence encodes the
gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A
base pair at position 60 (bold)
1
10
20
30
10
50
60
70
I-------
-------I-
-I-
-I-
I-
----
-----
----
5' ATCGGTCTCGGCTACTACATAAACGCGCGCATATATCSGATATCTAGCTAGCTATOGGTCTAGGCTACTAC
3' TAGCCAGAGCCGATGATGTATTTGCGCGCSTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG
Promoter
80
90
100
110
120
130
140
I----
I---------I------.
-I---------I-
--
CAGGTATCGGTCTGATCTAGCTAGCTTCTCTICTCICTCTCCCCCGCGGGGGCTGTACTATCATGCGTCG
3' GTCCATAGCCAGACTAGATOGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC
RBS
170
-I-
150
160
180
190
200
210
--I-
-I-
-------I-
-I--
I---------I
TCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGICTCGGCTACTACGTAAA
3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT
220
230
240
250
I------
I-
-I-------
5' CCCTATTAGCATGGGTCATATITGTGTCTGCTTGTTGGGT
3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps with 3 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?
What polypeptide would be produced from the following strand of DNA? The first pair of nucleotides (bolded) contains the start point of transcription. Label the C-terminus and N-terminus ends of the polypeptide. 3’-ATGCCTACGGGTACGCCACTACTCCC-5’ 5’-TACCCATGCCCATGCGGTGATGAGGG-3’
w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…