True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the first two bases specify the amino acid 3. most amino acids have many synonyms 4. each codon specifies more than one amino acid
Q: True or False 1. Histone proteins are able to associate with DNA segments because of the anionic…
A: Nucleic acid: It was first discovered by " Friedrich Miescher", from the pus cells nuclei . Nucleic…
Q: The Genetic Code * ( Choose True if the statement is correct abourt genetic code and False if…
A: Genetic code consists of nucleotides that code for specific amino acids in protein synthesis. Each…
Q: 1. What is a codon? 2. For eaxh of the following mRNA codons, give the tRNA anticodon and determine…
A: Central dogma of cell comprises of two important processes. They are transcription of DNA into mRNA…
Q: The drug, erythropoietin (EPO) is an artificial version of a protein that is naturally produced by…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: 64 codons specify 20 amino acids. There are two characteristics of codons: 1. No ambiguity: Each…
A: Genetic code is the sequence of nucleotides which specify amino acids.
Q: Now we need to know which amino acid the tRNA is carrying. We can do this on paper using the…
A: Strand mRNA codon tRNA anti-codon AA(short) AA(full name) Strand1: C-G-T-T-A-T-C-T-C-A-T-A-G-C-T…
Q: TRUE OR FALSE 1. Both strands of a daughter DNA molecule are formed through the linking of…
A: The nucleic acid polymer has nucleotide as its monomeric unit. Nucleotides are essential in the…
Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…
A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…
Q: Degeneracy of the genetic code denotes the existence of which of the following? A. codons that can…
A: Characteristic of genetic code: - The genetic code is a triplet (first suggested by Gamow in 1954).…
Q: Choose the correct option for following three mcqs 16.Termination codons differ from other codons…
A: Note: Please upload other questions separately. Answer: Introduction: A codon means an order of…
Q: an amino acid has a codon that ends in a pyrimidine, which of the following is not necessarily true?…
A: One of the most important property of genetic code is the code is degenerate. This means that a…
Q: In the genetic code, there are ___ More tRNAs than codons More codons than amino acids The same…
A: The DNA is transcribed into and mRNA sequence by the process of transcription. RNA contains three…
Q: Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In…
A: Nucleotide is the basic building block of nucleic acids. RNA and DNA are long chains of nucleotides.…
Q: Part of being a detective is being able to decode secret messages left behind by certain…
A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'
Q: Degeneracy of Genetic Code * ( Choose True if the statement is correct abourt and Degeneracy of…
A: Codon is the set of three nucleotide that encode an amino acid.
Q: 1. Describe the expirement that allowed researchers to first identify the codon for a specific amino…
A: Genetic code is a set of rules that help in determining how the information present on DNA or RNA is…
Q: DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and…
A: Codon is a base triplet that exists in DNA. DNA gets transcripted to mRNA which then translates to…
Q: codons is the term used to describe the genetic code because the rules that relate the nucleotide…
A: A codon is a three-nucleotide sequence of DNA or RNA that corresponds to a specific amino acid or…
Q: Which of the following statements below is incorrect? * A. the genetic code is overlapping B.…
A: As per guidelines, you have asked multiple questions we will solve the first question for you. If…
Q: 1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ mRNA: polypeptide chain:
A: (According to our regulations, we are required to answer only the first question in case of multiple…
Q: 7. Give all the possible Anti-codons for the amino acids listed below. Histidine (His) Isoleucine…
A: Codons is a sequence of three nucleotides that corresponds with a specific amino acid or stop signal…
Q: 1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the…
A: Since it is a multipart question we are supposed to answer only the first three questions as per the…
Q: True or False 1. The 2'OH in the sugars of RNA is advantageous to the molecule to facilitate its…
A: The 2'OH in the sugars of RNA is advantageous to the molecule to facilitate its hydrolysis:- RNA is…
Q: re 52 codons but only 51 amino acids in this protein. Why? (please refer to the attachment - the…
A: The basic building block of the nucleic acid id known as the nucleotides. The messenger RNA and DNA…
Q: Which of the following most accurately describes the anticodon? A. Contains a sequence…
A: Anticodon The base sequence of tRNA which pairs with codon of mRNA during translation is called…
Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…
A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…
Q: True or false Both pentose nucleic acid and deoxypentose nucleic acid contain the same pyrimidines…
A: Disclaimer: Since you have posted a question with multiple sub-parts, we will solve first three…
Q: Some tRNAs can recognize more than one codon because there is a relaxation of the complementation…
A: Translation of mRNA into protein requires a specialized adapter molecule called tRNA and ribosomes.…
Q: Which of the following is INCORRECT? The genetic code is contained in 20 different codons. All…
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Q: a) The genetic code in unambigous that means many codons can code for the same amino acids. b)…
A: 1. The genetic code is UNAMBIGUOUS:- Means that each triplet specifies only a single amino acid.…
Q: NASA sends a mission to Mars that brings back a new life form! It is carbon-based and its genetic…
A: Mars is an obvious source of inspiration for science fiction. It is common and well-read, yet unique…
Q: True or False 1.) The bonds linking bases and sugars are covalent.
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: How many initiation codons are there? a. 1 b. 3 c. 4 d. 20
A: Genetic codon or triplet codon basically serves the function of protein translation. Ribosomes are…
Q: 40/ In eukaryotes, there 3 A. 59 codons code for amino acids, while 5 codons are stop B 60 codons…
A: Introduction :- Eukaryotic cells have a membrane-bound nucleus, whereas prokaryotic cells do not.…
Q: Which of the following statements best explains why there are many more codons than there are amino…
A: The genetic codon is the sequence of three successive nucleotides present in the mRNA that codes…
Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…
A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a…
Q: The genetic instructions for the amino acid sequence of a polypeptide chain are written in DNA and…
A: The proteins are composed of amino acids that are connected with each other by peptide bonds and…
Q: Because of the way the genetic code structured, a point mutation in a given codon is likely to have…
A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…
Q: Degeneracy of Genetic Code True False each codon specifies more than one amino acid the first…
A: Genetic code consists of nitrogenous bases such as A, G, C, G, and U.It is a triplet code that codes…
Q: - up to 2 minutos): Which of the following statements about the genetic code is(are) true? OA Each…
A: Genetic code: It is a dictionary that involves a sequence of nucleotides and amino acids which is…
Q: 2. If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…
A: Answer :- Option (A) is correct. - 3.
Q: The sequence of subunits in a DNA molecule is more important to its function than the number of…
A: DNA instructions are translated into functional products using a 'Central Dogma'. The central dogma…
Q: The genetic code is Random in that the codons for the same amino acid are structurally unrelated…
A: Genetic code contains information that can be used by certain organelles to translate information…
Q: Which of the following is an example of the degeneracy of the genetic code An amino acid can have…
A: There are total 64 combinations of base pairs that is needed to code 20 main amino acids so more…
Q: The tRNA anticodon sequence 3’GAG 5’ is charged with the amino acid leucine. This anticodon may pair…
A: Normal complementary nucleic acid sequences bind to each other by Watson and Crick base pairing but…
Q: Which of the following statements are accurate descriptions of the genetic code? MARK ALL THAT APPLY…
A: Transcription is the process in which the mRNA copied information from DNA for protein synthesis.…
Q: Fill in the blanks: The Lys60 (encoded by 5'-AAG-3' codon) of a protein is critical for its binding…
A: The ribonucleic acid or RNA is produced from these DNA by transcription process. Different types of…
Q: AAC (DNA TRIPLET) = _______(mRNA CODON) = _________ AMINO ACID 2. TCG (DNA TRIPLET) = _______ (mRNA…
A: Transcription:- process of conversion of DNA to mRNA. Translation:- process of conversion of mRNA…
Q: 8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume…
A:
True or False
Degeneracy of Genetic Code:
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Degeneracy of Genetic Code * ( Choose True if the statement is correct abourt and Degeneracy of Genetic Code False if otherwise ) a given amino acid has more than one codon most amino acids have many synonyms each codon specifies more than one amino acid the first two bases specify the amino acidTable 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids A UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser UA tyr tyr term ala alanine term val valine UG cys cys term trp ile isoleucine leu leucine CU leu leu leu leu ser serine CC pro pro pro pro threonine proline aspartate glutamate lysine arginine thr CA his his gin gin pro asp glu lys CG arg arg arg arg AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gin AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu GG gly gly gly gly term termination 3. Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space provided. If the letters code for more than one amino acid, separate the names by dashes. b. UUA: c. GAG: d. UAUCUA: e. AUCUUG: f. AAGAGUUCG: g. AAAUUUGGG: h.…Degeneracy of Genetic Code True False each codon specifies more than one amino acid the first two bases specify the amino acid a given amino acid has more than one codon most amino acids have many synonyms
- When examining the genetic code, it is apparent that ________. there are 44 stop codons because there are only 20 amino acids there can be more than one codon for a particular amino acid AUG is a terminating codon the code is ambiguous in that the same codon can code for two or more amino acids there can be more than one amino acid for a particular codonTrue or false Both pentose nucleic acid and deoxypentose nucleic acid contain the same pyrimidines Both pentose nucleic acid and deoxypentose nucleic acid and deoxypentose nucleic acid Contain the same purines RNA contains cytosine and thymine DNA and RNA are hydrolysed by weak alkali The anticodon of tRNA finds the complementary codon on mRNA The amino acid is attached to end of tRNA The amino acid is recognized by the anticodon of tRNA A given tRNA can be charged with only one particular amino acidA small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.
- Order of Bases in Order of Bases in Order of Bases in Amino Acids coded DNA MRNA (codon) TRNA (anticodon) into Proteins TAG CAT GUC CCT GGA AUG Leucine CUUDNA A G T A C C G G G C A A A C T G C A T T G T G mRNA U C A U G G C C C G U U U G A C G U A A C A C Use the "Genetic Code Chart" to determine the sequence of amino acids in your polypeptide chain. Remember to START translation at the start codon by adding a Methionine and STOP translating when you reach a stop codon.Codon chart: We interpret mRNA 3 base pairs at a time. This is known as a codon. A codon table can be used to translate a genetic code into an amino acid sequence. The full set of relationships between codons and amino acids (or stop signals) is called the genetic code. The genetic code is often summarized in a table like the one below. Second letter A G UUU UUC J UGU Cys UCU) UCC UCA UCGJ UAU U Phe Tyr UACS UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UUG FLeu G CUU ) CỤC CUA CUG CCU ) ССС ССА CCG CGU CGC Arg CAU) CÁC His САА Leu Pro CGA Gin CAG CGG AUU AAU ACU АСC ACA Asn AGU Ser AAC JAsh AGC. AUC le A AUA AGA Arg Thr AAA AAG. }Lys A AUG Met ACG AGG J G GUU GUC G Val GUA GUG GCU) GCC GCA GCG GAU1 GACS GAA) GAG Glu GGU GGC Gly U C A Ala GGA GGG] G First letter UUAG Third letter
- Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterThe Genetic Code True False is universal is overlapping have synonyms specifying the same amino acids is a collection codonsThe genetic code is Random in that the codons for the same amino acid are structurally unrelated Read by pairing codons in TRNAS with anticodons in mRNAs Read by pairing anticodons in TRNAS with codons in MRNAS Redundant in that each codon can code for multiple amino acids