5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a specific one end and displays the appropriate unpaired at the end nearest the ribosomal groove. at A. amino acid -----1 base codon. B. amino acid C. histone ------3 base codon. D. amino acid,---- 3 base codon. E. dipeptide -----3 base codon. ----- 4 base codon. 6. The mRNA attaches to the ribosome and slides along until it encounters the sequence: A. AUG B. TAC C. UUU D. TCU E. TGU

5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a specific one end and displays the appropriate unpaired at the end nearest the ribosomal groove. at A. amino acid -----1 base codon. B. amino acid C. histone ------3 base codon. D. amino acid,---- 3 base codon. E. dipeptide -----3 base codon. ----- 4 base codon. 6. The mRNA attaches to the ribosome and slides along until it encounters the sequence: A. AUG B. TAC C. UUU D. TCU E. TGU

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 8SA: Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA

See similar textbooks

Similar questions

Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA
1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the anticodon in tRNA is CUU, what is the complementary codon? 3. How many synonyms code for arginine? 4. How many codons code for the amino acid cysteine? 5. How many codons code for the amino acid histidine? 6. How many codons code for the amino acid threonine?
What is the functional relationship between codons and amino acids? A Many different codons may code for the same amino acid B A single codon may code for many different amino acids C Codons and amino acids randomly associate around a particular tRNA D A given amino acid is only coded for by a single codon
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…
A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.
An alpha helix is a: O A. secondary structure found in proteins. O B. right-handed twist found in double-stranded DNA. O C. globular structure found in proteins. O D. post-translational modification of certain proteins. O E. helical region found in functional tRNAS.
In an amino acyl-tRNA, the amino acid is attached to the tRNA through a(n). acid and the CCA sequence at the bond between the group of an amino of a tRNA. А. Amide; Amino terminus; 5'-phosphate В. Ester; R-group; 3'-hydroxyl C: Ester; Carboxyl terminus; 5'-phosphate D. Ester; Carboxyl terminus; 3'-hydroxyl O E. Ether; Amino terminus; 3'-hydroxyl о
I’m supposed to translate tRNA into amino acids for each codon of the previous question and state what the amino acid chains become. For example: AUG AAA CGC CCA....
1. TRUE OR FALSE a) The genetic code in unambigous that means many codons can code for the same amino acids. b) There are no aminoacyl-tRNAs that will go to the A site of the ribosome when UGA is the codon.
2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT CCA CAG ACA * AGU AAA GGU GUc UGU 3. Translate the mRNA codons (i.e. your answer to question 2) into the appropriate amino acids using the following Universal Genetic Code Chart. * Universal Genetic Code Chart Messenger RNA Codons and the Amino Acids for Which They Code SECOND BASE A UCU UAU UGU UUU UUC UUA PHE TYR CYS UCC UCA UAC UGC SER UAA UGA STOP LEU STOP UUG UGG} TRP UCG UAG CUU CCU CAU CGU HIS CUC CCC CAC CGC LEU PRO ARG CCA CCG CUA CAA CGA GLN CUG CAG CG AUU AUC ACU AAU AGU AGC AGA ASN SER ILE ACC AAC THR AAA AAGS ACA AUA AUG MET or START LYS ARG ACG AGG S GCU GCC GUU GAU GGU ASP GUC GAC GGC VAL ALA GLY GUA GCA GCG GAA GGA GGG GLU GUG GAG トエーCロ ASE A, L-RST BASE
A small section of a gene for a protein has the following nucleotide sequence:CTG GGA TCC TAA GGTWhich of the following mutations would cause a nonsense mutation in the sequence shown above? Select one: a. Replacement of second adenine base with a cytosine base b. Insertion of guanine base after the first thymine base c. Insertion of guanine base after the first adenine base d. Replacement of second cytosine base with a adenine base