The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an
Q: Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before…
A: The transcription is the process by which RNA is produced from DNA. In case of eukaryotic mRNA, it…
Q: Are the following statements TRUE or FALSE?
A: a.It is a false statement. Post transcriptional RNA processing occurs in the nucleus of the cell and…
Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)
A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…
Q: Which of the following is involved in the termination of translation in bacteria? RF1 and RF2 A…
A: Stop codons are not read by tRNAs. Hence, incorrect. Ef Tu and Ef G are involved in elongation of…
Q: of hnRNA into mature mRNA incl
A: hnRNA can be defined as heterogeneous nuclear RNA. It also refers to the large pre‐mRNAs consisting…
Q: mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping.…
A: A codon is a triplet of the mRNA sequence, which identifies an amino acid. The genetic code tells…
Q: Processing of primary mRNA transcripts in eukaryotic cells DOES NOT involve which of the following?…
A: Ans:-C 1.What end does the poly A tail attach to? 3′ end A poly (A) tail is added to the 3′ end of…
Q: Which of the following best explains how the expression of a eukaryotic gene encoding a protein will…
A: The central dogma is common throughout the life forms on earth: i.e. DNA to RNA to Protein. Having…
Q: Which sequences within the pre-mRNA determine where splicing occurs?
A: RNA splicing is a process that produces a mature mRNA from a pre-mature mRNA. The process is started…
Q: How is it possible that a given mRNA in a cell is found throughout the cytoplasm but the protein…
A: Introduction The main crucial elements of the genome are the genes which controls all the cellular…
Q: a) Two of the following three mRNA sequences code for the same protein. Delete the sequence which…
A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…
Q: The following is the only intron sequence of a gene that will be excised during the maturation of…
A: In science, a gene is an essential unit of heredity and a succession of nucleotides in DNA or RNA…
Q: What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that…
A: Base sequence of mRNA Amino acid sequence UUG LEUCINE CCU PROLINE AGU SERINE GAU ASPARTIC…
Q: When production of a protein product from the mRNA is controlled by modifying the mRNA after it…
A: Post-transcriptional gene regulation is the regulation of a gene's expression at the RNA level; it…
Q: 11
A: Probably the earliest reference to age-related mental inadequacy is ascribed to Pythagoras in the 7P…
Q: The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the…
A: Splicing is one of the most important modifications which take place during mRNA maturation. There…
Q: Which of the following is not involved in the elongation of prokaryotic peptide? a. EE-Tus, EE-Ts,…
A: The translation is the process by which protein is synthesized with the help of mRNA, tRNA, and…
Q: Which of the following is true only for eukaryotic gene expression? mRNA is synthesized in the…
A: Note: Since the identifiers for the options are not mentioned, the options are assumed to be in the…
Q: Suppose the gene that produced this mRNA happens to mutate so that one of the codons in the middle…
A: Nucleic acids are the carrier of genetic information in the cells. DNA is the carrier of genetic…
Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…
A: mRNA stands for messenger RNA( Ribonucleic acid). Protein translation is a process of making…
Q: Which of the following statements about pre-mRNA splicing is FALSE? a. Splicing of an intron…
A: RNA splicing is a kind of RNA processing in which a newly formed pre-mRNA transcript is transformed…
Q: Which of the following is TRUE about MRNA splicing? O a. Splicing occurs after complete mRNA is…
A:
Q: Name and describe three types of modification that the mRNA undergoes in eukaryotes before the MRNA…
A:
Q: Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of…
A: Through transcription the DNA molecule is converted into mRNA.
Q: Which of the following processing events occur during or after the synthesls of MRNA molecules in…
A: Transcription It is the process of makin copy of RNA from DNA. This RNA is known as messenger RNA
Q: In eukaryotes, which of the following statements is correct with regard to introns and exons?…
A: Eukaryotic DNA carries the nonprotein coding sequences.
Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…
A: Answer: Central dogma replication----> transcription -------> translational DNA-------->…
Q: What is the anticodon that would pair up with the MRNA codon UAG? In What part of the cell is…
A: The central dogma of molecular biology includes replication, transcription and translation. Between…
Q: After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief…
A: In eukaryotes, the process of transcription and translation takes place in separate compartments.…
Q: The following is the only intron sequence of a gene that will be excised during the maturation of…
A: Prokaryotes have simpler cellular organization and gene structure when compared to eukaryotes.…
Q: explain which sequences within the pre-mRNA determine where splicing occurs? How? Why?
A: Splicing of a pre-mRNA molecule occurs in several steps that are catalyzed by small nuclear…
Q: The diagram shows a pre-MRNA before splicing and processing. In this cell type, a protein is present…
A: RNA-Splicing: In molecular biology, RNA splicing is the process by which a newly synthesised…
Q: Which of the following processes regulates the maturation of mRNA from hnRNA (in the control of gene…
A: mRNA In the world of RNA, mRNA is a type of RNA which contains codon in the form of triplets. These…
Q: the space below, list the events that would occur during the processing of a primary RNA transcript…
A: In eukaryotes, however, the RNA transcript must undergo processing before it is a functional mRNA.
Q: Which modification of eukaryotic mRNA is likely absent if the mRNA can leave the nucleus but cannot…
A: mRNAs are formed in the form of primary transcripts.
Q: What is the mechanism for addition of a guanosine to create the 5' methyl cap of a MRNA? O The 5'-OH…
A: Mature mRNA is an mRNA that is modified post-transcriptionally. Mature mRNA carries information from…
Q: Which of the following statements about how cells control the size of the poly-A tail on mRNA…
A: The mRNA or the messenger RNA is the pre-RNA which is derived from the DNA during transcription. The…
Q: A researcher studying late-onset Alzheimer's disease is interested in a gene, called ApoE, that…
A: Few important points should be kept : As we know non coding DNA is found within the most eukaryotic…
Q: eliminating the intron RNA immediately after it is excised from the pre-mRNA?
A: As we know that, the process of removing the introns and rejoining the coding section or exons ,of…
Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…
A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.
Q: What protein sequence would a cell make from the following mRNA? 5'- CCAUGCACCAAUAGAUAACCG-3' O PCTN…
A: During the translation, the sequence of nucleotides in the mRNA is translated into a sequence of…
Q: An mRNA that is translated into one polypeptide is called __________, while an mRNA that is…
A: Dear student answer of your question is given below: An mRNA that is translated into one…
Q: MRNAs and eukaryotic cells receive different modifications than those in prokaryotic cells, because…
A: It is a multiple choice question.
Q: Which of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the…
A: Messenger RNA (mRNA) acts as the template for protein synthesis. Though mRNA is associated with…
Q: A diagram of a gene is shown below. Normally, exons 1, 2, and 3 are present in the mature mRNA.…
A: The splicing is the process of eukaryotic mRNA processing and it is a post transcriptional…
Q: Which of the following is likely associated with the mRNA processing step of alternative splicing?
A: A process that helps a single gene to code for many proteins is known as alternate splicing. It is…
Q: The gene for Receptor Z contains an unknown number of untranslated first exons that are spliced to a…
A: * Given that the gene for receptor Z contains unknown number of untranslated first exons that are…
The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example.
ATAAGCCAGACTCAGCA
Step by step
Solved in 2 steps
- The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCCAGACTCGCAThe following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCACCAGACTCGCAAfter the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief moment occurs before the two exons are connected to each other. Which snRNP(s) hold(s) the exons in place so they can be covalently connected to each other?
- Introns are often very large and the cell has devoted mechanisms of eliminating them once they are excised from the pre-mRNA. Following intron excision, what specific ribonucleolytic enzymes or complexes contribute to eliminating the intron RNA immediately after it is excised from the pre-mRNA? Briefly describe the role of each step/enzyme and how it affects its RNA substrateEukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing steps is splicing, where portions of the RNA are removed and the remaining RNA are joined together. Classify the statements regarding mRNA splicing as true or false. True statements Splicing of mRNA does not involve any proteins. Answer Bank Splicing occurs while the mRNA is attached to the spliceosome. In splicing, intron sequences are removed from the mRNA in the form of lariats (loops) and are degraded. One mRNA can sometimes code for more than one protein by splicing at alternative sites. False statements Splicing occurs after the mRNA enters the cytoplasm but before it binds to the ribosome.What is the total size of the mature i.e. fully processed mRNA in nucleotides? How many amino acids would the encoded protein be? Assume that the N- terminal Met encoded by the AUG start codon, is NOT cleaved from the protein?
- As shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and six introns, which are numbered in green. A splicing repressor binds at the 3′ splice site at the end of intron 4, which is just before exon 5. What exons will be included in the mature mRNA?Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAGAssume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'
- The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the second intron of a eukaryotic gene. Due to this mutation, the second intron is now not ‘spliced out’ during the splicing process. What are the most likely consequences of this mutation with respect to the size of the pre-mRNA and the size of the mature mRNA? a. The pre-mRNA will be longer and the mature mRNA will be longer. b. The pre-mRNA will be longer and the size of the mature mRNA will not be affected c. The size of the pre-mRNA will not be affected and the mature mRNA will be longer d. The size of the pre-mRNA will not be affected and the size of the mature mRNA will not be affectedHemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. Give an example of how a mutation that altered the splicing sites in the pre-mRNA might lead to a premature stop codon in the gene.Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing steps is splicing, where portions of the RNA are removed and the remaining RNA are joined together. Classify the statements regarding mRNA splicing as true or false. True statements False statements In splicing, intron sequences are removed from the mRNA in the form of lariats (loops) and are degraded. Splicing occurs while the mRNA is still in the nucleus. Splicing of mRNA does not involve any proteins. One MRNA can sometimes code for more than one protein by splicing at alternative sites. Splicing occurs while the mRNA is attached to the nucleosome.