The following is the only intron sequence of a gene that will be excised during the maturation of the MRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCACCAGACTCGCA

Q: What happens to the pre-mRNA before it migrates to the cytoplasm? Explain

A: Answer: TRANSCRIPTION : It is the process in central dogma where DNA is transcribed in to RNA by…

Q: So the spliceosome is a structure that allows RNA splicing to occur, expelling the introns. Does…

A: spliceosome is a RNP complex found in eukaryotic Nucleus and is responsible for removal of introns…

Q: Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before…

A: The transcription is the process by which RNA is produced from DNA. In case of eukaryotic mRNA, it…

Q: Are the following statements TRUE or FALSE?

A: a.It is a false statement. Post transcriptional RNA processing occurs in the nucleus of the cell and…

Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)

A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…

Q: What process in mRNA folding leads to sensitivity to pain due to an effect on the COMT gene?

A: COMT is catechol-o- methyltransferase protein presence required for pain sensitivity.

Q: When an intron is undergoing the first step in splicing, where is the first breakage of the…

A: Gene splicing is a post translational process, which is a characteristic of eukaryotes and it…

Q: of hnRNA into mature mRNA incl

A: hnRNA can be defined as heterogeneous nuclear RNA. It also refers to the large pre‐mRNAs consisting…

Q: Describe the various post-transcriptional and post-translational modifications that occur during the…

A: Post-transcriptional modifications are those modifications that occur after the completion of…

Q: Processing of primary mRNA transcripts in eukaryotic cells DOES NOT involve which of the following?…

A: Ans:-C 1.What end does the poly A tail attach to? 3′ end A poly (A) tail is added to the 3′ end of…

Q: Describe the three major modifications that occur duringthe processing of an mRNA.

A: the three major modifications that occur during the processing of an mRNA are :

Q: Which sequences within the pre-mRNA determine where splicing occurs?

A: RNA splicing is a process that produces a mature mRNA from a pre-mature mRNA. The process is started…

Q: How is it possible that a given mRNA in a cell is found throughout the cytoplasm but the protein…

A: Introduction  The main crucial elements of the genome are the genes which controls all the cellular…

Q: Which of the following is required for RNA splicing to occur?

A: RNA splicing is the process in which newly made precursor m-RNA is transferred into a mature mRNA.

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: pre mRNA can be spliced in more than one way, permitting a single gene to produce multiple mRNAs…

A: Pre mRNA can be defined as a primary mRNA transcript,which is formed during transcription.This pre…

Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…

A: Hemophilia -- It occurs in about 1 of every 5000 males .     Usually a inherited disorder in which…

Q: As shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and…

A: The pre-mRNA is formed from the DNA, which is further spliced to form mature mRNA. Splicing refers…

Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…

A: mRNA stands for messenger RNA( Ribonucleic acid).  Protein translation is a process of making…

Q: Which of the following statements about pre-mRNA splicing is FALSE? a. Splicing of an intron…

A: RNA splicing is a kind of RNA processing in which a newly formed pre-mRNA transcript is transformed…

Q: There is a specific enzyme that adds the 5' Cap to mRNA. If an inhibitor of this enzyme were added…

A: Cap in RNA is a molecule of 7 methyl guanosine at 5' end.

Q: Eucaryotic

A: Introduction:-  Heterogeneous nuclear RNA or hn RNA is a term that encompasses various types and…

Q: Which of the following processing events occur during or after the synthesls of MRNA molecules in…

A: Transcription  It is the process of makin copy of RNA from DNA. This RNA is known as messenger RNA

Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…

A: Answer: Central dogma  replication----> transcription -------> translational  DNA-------->…

Q: When scientists cut a eukaryotic gene from genomic DNA, they discovered that enabling the strands to…

A: Alternative splicing is a method through which a messenger RNA may control the creation of many…

Q: What is the anticodon that would pair up with the MRNA codon UAG? In What part of the cell is…

A: The central dogma of molecular biology includes replication, transcription and translation. Between…

Q: After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief…

A: In eukaryotes, the process of transcription and translation takes place in separate compartments.…

Q: What is the order of the tRNA binding sites on the 70S ribosome with respect to the 5' 3' direction…

A: Each ribosomal subunit has three binding sites for tRNA:  the A (aminoacyl) site, which accepts the…

Q: The following is the only intron sequence of a gene that will be excised during the maturation of…

A: Prokaryotes have simpler cellular organization and gene structure when compared to eukaryotes.…

Q: explain which sequences within the pre-mRNA determine where splicing occurs? How? Why?

A: Splicing of a pre-mRNA molecule occurs in several steps that are catalyzed by small nuclear…

Q: The diagram shows a pre-MRNA before splicing and processing. In this cell type, a protein is present…

A: RNA-Splicing:  In molecular biology, RNA splicing is the process by which a newly synthesised…

Q: what is the difference between leader mRNA and attenuator sequence? Please explain the function of…

A: Operon is a genetic regulatory system found in bacteria and their viruses in which genes coding for…

Q: Do the following events during bacterial translation occur primarily within the 30S subunit, within…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: Mhich of the following polypeptides is coded for my the MRNA sequence 5' AUGGUUAAACGACAAUCC 3 ?

A: The amino acids are selected and wrote in the sequence as first, second and third base. The process…

Q: When an intron is undergoing the first step in splicing, where is the first breakage of the…

A: During the first step of splicing, the 2'-OH group on branch point A attacks the phosphoryl group of…

Q: Which of the following statements about how cells control the size of the poly-A tail on mRNA…

A: The mRNA or the messenger RNA is the pre-RNA which is derived from the DNA during transcription. The…

Q: A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon…

A: Splicing is a process of removal of non-coding sequences and the joining of coding sequences. The…

Q: eliminating the intron RNA immediately after it is excised from the pre-mRNA?

A: As we know that, the process of removing the introns and rejoining the coding section or exons ,of…

Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…

A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…

Q: Gene X codes for a protein in eukaryotes. A mutated eukaryotic cell contains an altered base-pair in…

A: Gene is present in the DNA. The gene is a sequence of nucleotides that encode a polypeptide. The…

Q: Alternative splicing of the same pre-mRNA produces two isoforms.

A: 30) During RNA splicing , the introns are precisely excised and exons are ligated together. However…

Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4…

A:

Q: Which of the followings indicate the order of procaryotic mRNA degreadation?   cleavage of the…

A: Messenger RNA (mRNA) acts as the template for protein synthesis. Though mRNA is associated with…

Q: A diagram of a gene is shown below. Normally, exons 1, 2, and 3 are present in the mature mRNA.…

A: The splicing is the process of eukaryotic mRNA processing and it is a post transcriptional…

Q: Which of the following is likely associated with the mRNA processing step of alternative splicing?

A: A process that helps a single gene to code for many proteins is known as alternate splicing. It is…

Q: Discuss the advantages, in terms of protein structure and evolution, that result from alternative…

A: Alternate splicing allows a single gene to code for multiple proteins. The protein translated from…

Q: The gene for Receptor Z contains an unknown number of untranslated first exons that are spliced to a…

A: * Given that the gene for receptor Z contains unknown number of untranslated first exons that are…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.