The figure above shows succession in an ecosystem. What organisms are found in the climax community for this ecosystem? White spruce Balsam fir Paper birch Aspen Black spruce Jack pine Grasses Herbs Shrubs Tree seedlings OOO Lichens Mosses weeds and grasses trees and shrubs lichens and moss volcanoes and soil

Q: 18. Which of the following entities has the largest interaction cross-section (most likely to…

A: Tissues are group of cells having similar function and structure.

Q: Embryo mRNA in dormant seeds is expressed at germination. O Pre-transcriptional control O…

A: Following synthesis, some proteins are dormant unless they are stimulated, which can be accomplished…

Q: what anatomical system of praying mantis and crab would you recommend as a target of attack and why?

A: Mantis is insect contains over 2,400 species in about 460 genera in 33 families.Mantis are found in…

Q: 1. Stress can affect the epigenome of an individual. II. Depending on the affected site, epigenetic…

A: The phrase epigenome comes from the Greek word epi, which means "above" the genome. The epigenome is…

Q: In 1798, a stuffed platypus specimen was delivered tothe British Museum. Reports that it laid eggs…

A: Amniotes are described as the vertebrates that have a tendnecy to develop embryo in the amnion.…

Q: Please answer the recent examples or studies about cloning entire organisms in 1. Plants 2. Animals

A: Cloning is a laboratory procedure that creates genetically identical organisms via non-sexual ways.…

Q: What are the natural plants that the body can consume that speed up the burning process

A: The procedure through which our body transforms what we eat or drink into energy is known as…

Q: rections: Create a concept map of homeostasis by filling out the white-filled xes. Afterwards,…

A: Homeostasis It is defined as a process used by living organisms to maintain the optimal functioning…

Q: arasympathethic stimulation of the lungs causes   bronchi to dilate bronchioles to dilate bronchi to…

A: The autonomic nervous system is divided into the parasympathetic nervous system and the sympathetic…

Q: Many drugs work by interfering with the inactivation of neurotransmitters once they gave been…

A: The body possesses several chemical messengers which are known as neurotransmitters. These…

Q: 2. The genotype of F₁ individuals in a tetrahybrid cross is AaBb assortment of these four genes,…

A: A trait is characteristic feature that is unique to particular individual. A tetrahybrid cross is a…

Q: 1. Identical twins may show dissimilar phenotypes due to changed methylation patterns of the…

A: * monozygotic twins even they are genetically identical there will be some  variation in them the…

Q: How will you solve the problematic taxon based on systematic and phylogeny?

A: Answer-- A taxon is defined as a single species that may represent two or more sibling species that…

Q: What are the monoclonal antibodies: a) antibodies produced in one animal; b) antibodies delivered in…

A: Antibodies are specialised Y shape proteins that binds  to the foreign invaders -whether they are…

Q: How might one test whether the differences in moth density in the two types of plants are due to…

A: Answer :- When sent consistently in the field, hereditarily controlled plant obstruction is…

Q: Algal blooms occur due to the presence of an excess amount of nutrients, like phosphorus, in fresh…

A: Algal blooms are defined as the fast growth of algae in bodies of water.

Q: Table 13: Common Names and Scientific Names of Some Organisms Scientific Name Common Name Genus Name…

A: Introduction The science of naming, describing, and classifying groups of biological species based…

Q: Briefly describe endocrine disruptors, how they act, toxicity caused and the effects they bring…

A: Hormones are chemical substances produced by our body's endocrine system, which releases the…

Q: this assignment let us assume that your class are a group of expert biologist task with…

A: Various animals have variety of weaknesses which can be exploited based on the knowledge about…

Q: . functional insulin required the association of two polypeptides known as the A and B chains

A: Insulin is a hormone generated by the beta cells of the islets of Langerhans in the pancreas that…

Q: a separate sheet of paper. 3 MONTHS MONTHS MONTHS MONTHS 6 MONTHS 5 MONTHS PROCESS: FETAL…

A: Humans are sexually reproducing and Vviparous. The reproductive events in humans inciude formation…

Q: Discuss the results of the data Topic: Tests for Hydrocarbons experiment

A: In this test of hydrocarbons there is ignition testing the determine hydrocarbon the first test is…

Q: Which type of circulation ensures enough oxygenated blood will be supplied to the different parts of…

A: Introduction Circulatory system:- It is the system that contains the heart and the blood vessels and…

Q: Turtles, lizards, and birds belong to one major lineage of amniotes, and_______ belong to another.…

A: Introduction:- Amniotes are vertebrates that grow their embryos in a sac called an amnion. A…

Q: Please answer asap and in short and content should not be palgarised please This field is a…

A: ANSWER;- D) biotechnology Explain;- Biotechnology is the utilization of science to take care of…

Q: Normal vision father X normal vision ( carrier) mother

A:

Q: Which of the following replication enzymes will most likely be involved in COVID19 RNA replication?…

A: Coronaviruses (CoVs) are the most common type of virus in the Nidovirales order, which comprises the…

Q: Explain how snakes are related to lizards

A: Snakes and lizards are closely related to each other that belongs tothe order squamata of the…

Q: Outline the mechanistic steps that can unwind the E.coli's DNA to initiate the DNA replication.

A: DNA replication has been well studied in bacteria primarily because of the small size of the genome…

Q: enzymes ECORI and HINDIII are called "compatible" enzymes. DNA cut with these enzymes can be ligated…

A: Restriction Endonucleases Restriction endonucleases or restriction enzymes are the enzymes that can…

Q: . differential lengths of poly-A tails affect mRNA stability a. pre-transcriptional control b.…

A: In the cytoplasm, the poly(A) tail interacts with the 5′ end of mRNA via eIF-4G, which binds both…

Q: in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region…

A: Transcription is the process of formation of transcript that is mRNA from DNA. It is catalysed by…

Q: True or false. The separation of populations due to the emergence of barriers is referred to as…

A:

Q: Both statements are false. I. In Arabidopsis thaliana, cytosine demethylation within the Superman…

A: SUPERMAN gene involved in the formation of boundary between stamen and carpel in flower.  If…

Q: QUESTION 29 Candida albicans is a [A] that is (83, it can grow in a yeast [C] [D] form, it is the…

A: Candida albicans is non phototropic (i) that is Fungi (A), it can grow  in a yeast, hypae (C)and…

Q: Which statement best describes cellular respiration? it is the conversion of food energy into a more…

A: Answer is 1st option correct

Q: Huntington's disease is a genetic disorder in humans which is controlled by a dominant gene. If one…

A: Huntington's disease is an inherited genetic disorder that is passed on as an autosomal dominant…

Q: What is a single word that defines a characteristic of most Herpesviruses? Answer: I

A: Herpes virus are very hard to treat due to their complex genome despite having high quality drugs…

Q: The ____and_____ are grouped as Ecdysozoabecause they both molt.a. cnidarians/arthropods c.…

A: As they mature, all members of Ecdysozoa superphylum molt or lose their cuticle. They secrete a…

Q: I. Individuals diagnosed with autism can have reduced expression of the oxytocin gene due to…

A: The majority of mutations develop when the DNA fails to duplicate correctly. All of these mutations…

Q: CGG CCA UGU AUA UAA Enter your answer as a string without dashes, using three-letter abbreviations…

A: DNA ( Deoxyribonucleic acid) is a ladder like helical structure which serves as genetic material in…

Q: In differential translation, a different transcript may be recovered depending on which TATA box is…

A: Mutation refers to both the process of altering a gene or chromosome and the outcome of that…

Q: The following truncated sequences are the receptor binding domain of COVID19’s & SARS’ S-protein,…

A: A virus's receptor-binding domain (RBD) is a critical component of the virus's'spike' domain that…

Q: What are the adaptive structures of the ectoparasites and the endoparasites? Compare and contrast…

A: Any organism that obtains its nutrition from the inner surface or the outer surface of the host is…

Q: In ELISA, what is the importance of washing? When does washing is performed?

A: Introduction :- Enzyme-linked immunoassay (ELISA) is an acronym for enzyme-linked immunoassay.…

Q: Define death in physiological terms. We know that when the human heart stops beating, it can be…

A: The cardiovascular system is a network of arteries and veins in which the heart pumps blood. One of…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.

Q: How does hydrochloric acid aid in the digestion of food?     Hydrochloric acid breaks down the…

A: HCl helps in digestion of protein. It protects body from infection.

Q: Interpret the level of gene expression of the lac operon, as well as the status of the lac repressor…

A: 1) Bacterial growth media contains lactose the lac repressor loses its DNA binding ability and it…

Q: Make a food web consisting of (rice, cooking oil, oyster sauce, green peas, Onion, Garlic, Egg

A: There are lot of common points in between the several food chains. These common points form the…