T0.5 STRUCTURE O 30 nm 30 nm 30 nm Histone- octamer (a) Micrograph of (b) Solenoid model (c) Zigzag model a 30-nm fiber FIGURE 10.13 The 30-nm fiber. (a) A photomicrograph of the 30-nm fib (b) In the solenoid model, the nucleosomes are packed in a helical configuration. (c) the zigzag model, the linker DNA forms a more irregular structure, and less contact curs between adjacent nucleosomes. The zigzag model is consistent with more recen data regarding chromatin conformation. (a): © Jerome Rattner/University of Calgary
Q: 18. Chaperones are frequently associated with polypeptides as they are being synthesized from the…
A: Chaperons are proteins that are primarily concerned with protein folding. It prevents the…
Q: give the structure of post Squence 5'-AGCTA-3! Complete and give the Sturaute Structure. at…
A: DNA and RNA stand for deoxyribonucleic acid and ribonucleic acid respectively. DNA is…
Q: 13. Shape and dimension. (a) Tropomyosın, a 70-kDa muscle protein, is a two-stranded a-helical…
A: Secondary structure of protein: Formed due to twisting of the polypeptide chain.The folding is due…
Q: You have been sent the first samples of a newly discovered Martian microorganism for analysis of its…
A: Packaging of Eukaryotic DNA is highly ordered. Initially the DNA(negatively charged) is conjugated…
Q: Structure of lactam.. 1) Why this lactam would be evolutionarily selected against? a. Amino acids…
A: β-lactam antibiotics are antibiotics that contain a beta-lactam ring in their chemical structure.…
Q: 5′ - A U G C A A U A C A A U C C G G A A U G A - 3′ Give the primary structure of the protein that…
A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…
Q: 4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red…
A: The genetic information always flow from DNA to RNA to proteins. This flow of information is known…
Q: 10.18 Using the information in Figs. 10.14 and 10.18, explain how the two oligonucleotides…
A: Deoxyribonucleotides are the building blocks of DNA. Each nucleotide is composed of five carbon…
Q: Write the names of the appropriate regions on L-shaped structure of TRNAS. 13' 15'
A: The process of protein synthesis involves transcription and translation. In transcription, DNA is…
Q: Define helicase
A: The process of transcription in prokaryotes requires the double-helical DNA to partly unwind in the…
Q: a) A protein is found to be a tetramer of identical subunits. Name two symmetries possible for such…
A: Tetramer - A tetramer is an oligomer formed from four monomers or subunits.
Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…
A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…
Q: Lysosomal hydrolases contain sorting signals that mark these proteins for modification with mannose…
A: In order to test this signal, we have to prepare a synthetic gene which codes for hydrolase enzyme.…
Q: Okazaki fragments in bacterial cells are 1000–2000 nucleotides in length. Those in eukaryotic cells…
A: In the bacterial cell, the length of the Okazaki fragment is 1000-2000 nucleotides, while in…
Q: - (a) A protein is found to be a tetramer of identical subunits. Name two symmetries possible for…
A: (a) A tetramer could have a heterologous interaction that would give rise to a C4 symmetry as well…
Q: 4. A polypeptide comprised of 17 amino acid res- idues with the sequence on the right is ob-served…
A: The peptide sequence using 3 letter amino acid code is given below.…
Q: 64. Cooperativity in the unfolding process during protein denaturation suggests that loss of A.…
A: Cooperativity in the unfolding process during protein denaturation suggests the loss of (C)…
Q: If viroids are circular molecules, why are they depictedas hairpins?
A: Viroids are the small infectious agents which consist of single stranded RNA as their genetic…
Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…
A: The X-ray diffraction is one of the analytical techniques in which the X-rays are used for analysis…
Q: Shape and dimension. (a) Tropomyosin, a 70-kDa muscle protein, is a two-stranded α-helical coiled…
A: Secondary structure of protein: Formed due to twisting of polypeptide chain.The folding is due to…
Q: Lysosomal hydrolases contain sorting signals that mark these proteins for modification with mannose…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the…
A: Fos-jun family proteins are a class of proteins that belong to a large group of DNA binding proteins…
Q: Explain why a 50S ribosomal subunit and a 30S ribosomal subunit combine to form a 70S subunit,…
A: Ribonucleoproteins form the basic unit of ribosomes and they are a complex of RNA and proteins. They…
Q: 1. Heterochromatin is typically gene-rich and composed of loosely-packed DNA that is…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: (a) dues in the polypeptide. Place the label or an arrow on the Ca atom of both residues. Label the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 23. Contrast the “functional” size of the four major classes of biomolecules. Background: Up…
A: Carbohydrates, proteins, lipids, and nucleic acids are the four major biomolecules. Carbohydrates…
Q: inans 5' 3' MRNA For our Unit 12 discussion on gene expression, please answer the following: 1.…
A: The genetic material in the cell contains various genes that codes for mRNA ( messenger RNA) by…
Q: 10-7 Monomeric single-pass transmembrane proteins span a membrane with a single a helix that has…
A: The cell membrane is a lipid bilayer with a hydrophobic interior. Transmemebrane proteins span the…
Q: A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein…
A: DNA is the genetic material in humans. It carries information that is transferred from one…
Q: Under physiological conditions, DNA ordinarily formsB-DNA. However, RNA hairpins and DNA-RNAhybrids…
A: DNA and RNA are the biomolecules that are responsible for carrying genetic information in all living…
Q: The so-called kelch motif consists of a four-stranded β sheet, which forms what is known as a β…
A: Introduction Proteins are huge biomolecules and macromolecules that are made up of one or more long…
Q: A diploid human cell contains approximately 6.4 billion base pairs of DNA. Q. How many nucleosomes…
A: Number of base pairs in human diploid cell= 6.4 x 109 base pairs Given that linker DNA contains 40…
Q: Explain the one turn/two turn joining (12/23; heptamer/nonamer) rule for VL to JL, DH to JH, and VH…
A: Antibodies in humans consists of heavy and light chains of amino acids, each of which contains…
Q: KIF1A has only a single motor domain. What additional structural elements would you expect to find…
A: KIF1A is kinesin like protein ,which act as the axonal transporter of synaptic vesicles or…
Q: 76) Nuclear localization signal can be a. Simple sequence in which we have a stretch of acidic amino…
A: A nuclear localization signal (NLS) is an amino acid pattern that 'marks' a polypeptide for nuclear…
Q: A diploid human cell contains approximately 6.4 billion base pairs of DNA. a. How many nucleosomes…
A: A nucleosome is the basic repeating unit of the eukaryotic chromosome. In human chromosome, about 6…
Q: The ends of eukaryotic chromosomes terminate in a G-rich singlestrandedoverhang that can fold up on…
A: Introduction: The compact form of DNA is known as chromosome. It is present inside the nucleus of…
Q: I only need letter D
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…
Q: (a) Tropomyosin, a 70-kDa muscle protein, is a two-stranded α -helical coiled coil. Estimate the…
A: Tropomyosin is a two-stranded alpha-helical , coiled coil protein found in actin-based…
Q: 17. How would you computationally predict the thermodynamic stability of a long, extended RNA helix?…
A: Thermodynamic stability is the state when the structure is in a conformation that has the lowest…
Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…
A: Fibroins are insoluble proteins that are present in silk produced by insects, such as the larvae of…
Q: A molecule of composition5′-AAAAAAAAAAA-3′3′-TTTTTTTTTTTTT-5′is replicated in a solution containing…
A: Atoms with unstable nuclei regain what is supposed to describe as they are about to define stability…
Q: Briefly explain why a "Folding Funnel" is used to represent the kinetics of folding (limit 5-6…
A: Proteins are polymers of amino acids. In a protein amino acids are arranged in a specific sequence…
Q: "The helix must undergo localized unwinding, and theresulting “open” configuration must be…
A: DNA is the genetic and hereditary material in all living cells (except a few viruses). DNA is passed…
Q: Protein A has a pl of 6.5 and appears to form tetramers. Protein B has a pl of about 8.5, and…
A: Histone proteins are strongly basic protein due to abundant lys and arg residues. It is found in the…
Q: Cordycepin (structure shown), a broad-spectrum antibiotic was used to treat a bacterial infection.…
A: Antibiotics are potent medications that fight infections and, when taken correctly, can save lives.…
Q: Draw the molecular formula of the covalently modifi ed histone side chain of acetyllysine. How does…
A: Histones are proteins that are found in nucleosomes. The histone proteins play an essential role in…
Q: 24. During the disassembly of a nucleosome which part of the nucleosomes is the first to be removed.…
A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…
Describe the distinguishing features of the solenoid and zigzag models
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- (a) Draw the structure of the high-energy nucleoside triphosphate GTP. (b) Draw the structure of the hydrolysis product formed when one phosphate is removed.(a) Tropomyosin, a 70-kDa muscle protein, is a two-stranded α -helical coiled coil. Estimate the length of the molecule. (b) Suppose that a 40- residue segment of a protein folds into a two-stranded antiparallel β structure with a 4-residue hairpin turn. What is the longest dimension of this motif?Figure 1 shows the structure of adenine and thymine. (i) (ii) NH adenine C-H thymine Figure 1 Illustrate the potential tautomers of adenine and thymine. Draw a chemical structure of Thyminc-Adenine (T-A) base pair and label the patterns of hydrogen bond acceptors, donors in the major groove of the TA base pair.
- 7. 1 B e here to search Required Study the two diagrams below. Diagram A 2 1 Diagram B 2 Based on the sequence of steps (1, 2, 3), which of the diagrams shows what would happen to proteins made at the ribosomes and transported to the outside of the cell? Diagram A Diagram B Both Diagram A and Diagram B Neither Diagram A nor Diagram B DELL 40)(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21Suppose you have two genetic variants of a large protein that differ only inthat one contains a histidine (side chain pKa = 6.0) when the other has avaline (uncharged side chain).(a) Which would be better for separation: gel electrophoresis or isoelectricfocusing? Why?(b) What pH would you choose for the separation?
- In the context of cell biology, what do we mean by form follows function? What are at least two examples of this concept?Bacteriorhodospin (Mw = 26 kDa) is a protein with purple colour. The protein acts as a light-activated proton pump that provides energy for cellular functions. The structure, revealed by both electron microscopy and X-ray crystallography, showed that the protein consists of 7 transmembrane spanning helices (TMH). Each TMH traverses the lipid bilayer completely (thickness of 45 Å). a)Calculate the minimum number of amino acid residues needed per TMH to completely cross the membrane. b)Estimate how large a fraction of the bacteriorhodopsin protein that is made up by TMHs. c)Now that you know the fraction of the protein that is made up by TMHs, at which ψ/φangles will the amino acids cluster in a Ramachandran plot?i. A schematic structure of the subunit of hemerythrin (an oxygen-binding protein from invertebrate animals) is shown to the right. (a) It has been found that in some of the a-helical regions of hemerythrin, about every third or fourth amino acid residue is a hydrophobic one. Suggest a structural reason for this finding. (b) What would be the effect of a mutation that placed a proline residue at point A in the structure?
- TERTIARY STRUCTURE (A) (B) (C) Fg Eet Galand Sen 20e Figure 6. Examples of the arrangement of a-helices and B-sheets in folded protein domains. Copyright 2013 from Essential Cell Biology, 4th Edition by Alberts et al. Reproduced by permission of Garland Science/ Taylor & Francis LLC. Figure 6 shows three examples of how secondary structure elements can be arranged in relation to one another in the functional, folded form of a complete protein or one compact portion of a protein. The overall three-dimensional shape (or conformation) of a protein is its tertiary structure. • What do you think holds together the various secondary structural elements in a particular three-dimensional pattern? (Hint: Look back at Figure 5 - what is sticking out from the sides of the a-helices and B-strands?)2.3 Manylendosomes become acidic because they have transporters in their membranes that pump H+ ions into the endosomal lumen. Which of the following statements is true? A) acidification of the endosomal lumen is critical for RNA vaccines because it increases the charge of the cationic lipids in the LNP's and thereby promotes fusion with cationic lipids in the endosomal membrane. B) RNAS are stabilized by high pH c) the pumping of H+ into the endosome likely requires energy from cellular ATP D) H+ catalyzes the conversion of pseudouridine into uridine, which is necessary before the MRNAS can be translated.- (a) A protein is found to be a tetramer of identical subunits. Name two symmetries possible for such a molecule. What kinds of interac- tions (isologous or heterologous) would stabilize each? (b) Suppose a tetramer, like hemoglobin, consists of two each of two types of chains, a and B. What is the highest symmetry now possible?