T0.5 STRUCTURE O 30 nm 30 nm 30 nm Histone- octamer (a) Micrograph of (b) Solenoid model (c) Zigzag model a 30-nm fiber FIGURE 10.13 The 30-nm fiber. (a) A photomicrograph of the 30-nm fib (b) In the solenoid model, the nucleosomes are packed in a helical configuration. (c) the zigzag model, the linker DNA forms a more irregular structure, and less contact curs between adjacent nucleosomes. The zigzag model is consistent with more recen data regarding chromatin conformation. (a): © Jerome Rattner/University of Calgary

T0.5 STRUCTURE O 30 nm 30 nm 30 nm Histone- octamer (a) Micrograph of (b) Solenoid model (c) Zigzag model a 30-nm fiber FIGURE 10.13 The 30-nm fiber. (a) A photomicrograph of the 30-nm fib (b) In the solenoid model, the nucleosomes are packed in a helical configuration. (c) the zigzag model, the linker DNA forms a more irregular structure, and less contact curs between adjacent nucleosomes. The zigzag model is consistent with more recen data regarding chromatin conformation. (a): © Jerome Rattner/University of Calgary

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter4: Cell Structure

Section: Chapter Questions

Problem 35CTQ: In the context of cell biology, what do we mean by form follows function? What are at least two...

See similar textbooks

Similar questions

(a) Draw the structure of the high-energy nucleoside triphosphate GTP. (b) Draw the structure of the hydrolysis product formed when one phosphate is removed.
(a) Tropomyosin, a 70-kDa muscle protein, is a two-stranded α -helical coiled coil. Estimate the length of the molecule. (b) Suppose that a 40- residue segment of a protein folds into a two-stranded antiparallel β structure with a 4-residue hairpin turn. What is the longest dimension of this motif?
Figure 1 shows the structure of adenine and thymine. (i) (ii) NH adenine C-H thymine Figure 1 Illustrate the potential tautomers of adenine and thymine. Draw a chemical structure of Thyminc-Adenine (T-A) base pair and label the patterns of hydrogen bond acceptors, donors in the major groove of the TA base pair.
7. 1 B e here to search Required Study the two diagrams below. Diagram A 2 1 Diagram B 2 Based on the sequence of steps (1, 2, 3), which of the diagrams shows what would happen to proteins made at the ribosomes and transported to the outside of the cell? Diagram A Diagram B Both Diagram A and Diagram B Neither Diagram A nor Diagram B DELL 40)
(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21
Suppose you have two genetic variants of a large protein that differ only inthat one contains a histidine (side chain pKa = 6.0) when the other has avaline (uncharged side chain).(a) Which would be better for separation: gel electrophoresis or isoelectricfocusing? Why?(b) What pH would you choose for the separation?
In the context of cell biology, what do we mean by form follows function? What are at least two examples of this concept?
Bacteriorhodospin (Mw = 26 kDa) is a protein with purple colour. The protein acts as a light-activated proton pump that provides energy for cellular functions. The structure, revealed by both electron microscopy and X-ray crystallography, showed that the protein consists of 7 transmembrane spanning helices (TMH). Each TMH traverses the lipid bilayer completely (thickness of 45 Å). a)Calculate the minimum number of amino acid residues needed per TMH to completely cross the membrane. b)Estimate how large a fraction of the bacteriorhodopsin protein that is made up by TMHs. c)Now that you know the fraction of the protein that is made up by TMHs, at which ψ/φangles will the amino acids cluster in a Ramachandran plot?
i. A schematic structure of the subunit of hemerythrin (an oxygen-binding protein from invertebrate animals) is shown to the right. (a) It has been found that in some of the a-helical regions of hemerythrin, about every third or fourth amino acid residue is a hydrophobic one. Suggest a structural reason for this finding. (b) What would be the effect of a mutation that placed a proline residue at point A in the structure?
TERTIARY STRUCTURE (A) (B) (C) Fg Eet Galand Sen 20e Figure 6. Examples of the arrangement of a-helices and B-sheets in folded protein domains. Copyright 2013 from Essential Cell Biology, 4th Edition by Alberts et al. Reproduced by permission of Garland Science/ Taylor & Francis LLC. Figure 6 shows three examples of how secondary structure elements can be arranged in relation to one another in the functional, folded form of a complete protein or one compact portion of a protein. The overall three-dimensional shape (or conformation) of a protein is its tertiary structure. • What do you think holds together the various secondary structural elements in a particular three-dimensional pattern? (Hint: Look back at Figure 5 - what is sticking out from the sides of the a-helices and B-strands?)
2.3 Manylendosomes become acidic because they have transporters in their membranes that pump H+ ions into the endosomal lumen. Which of the following statements is true? A) acidification of the endosomal lumen is critical for RNA vaccines because it increases the charge of the cationic lipids in the LNP's and thereby promotes fusion with cationic lipids in the endosomal membrane. B) RNAS are stabilized by high pH c) the pumping of H+ into the endosome likely requires energy from cellular ATP D) H+ catalyzes the conversion of pseudouridine into uridine, which is necessary before the MRNAS can be translated.
- (a) A protein is found to be a tetramer of identical subunits. Name two symmetries possible for such a molecule. What kinds of interac- tions (isologous or heterologous) would stabilize each? (b) Suppose a tetramer, like hemoglobin, consists of two each of two types of chains, a and B. What is the highest symmetry now possible?