A molecule of composition5′-AAAAAAAAAAA-3′3′-TTTTTTTTTTTTT-5′is replicated in a solution containing unlabeled (notradioactive) GTP, CTP, and TTP plus adenine nucleoside triphosphate with all its phosphorus atoms in theform of the radioactive isotope 32P. Will both daughtermolecules be radioactive? Explain. Then repeat thequestion for the molecule5′-ATATATATATATAT-3′3′-TATATATATATATA-5′

Q: 1. An albino man whose parents are both normal marries a woman one whose parents is normal and the o...

A: Introduction Albinism is an inherited condition that leads to someone having very light skin, hair, ...

Q: If the purity of DNA sample is below 1.8 A260/A280, where did the protein contamination come from?

A: The absorbance ratio at 260 nm & 280 nm is used to determine the quality of DNA & RNA.  A ra...

Q: is the collective term for actin and myosin. sarcomere O myofibrils O muscle hiber O skeletal muscle

A: The basic contractile unit of muscle fibre is the sarcomere. Actin and myosin are the active compone...

Q: A recognized set of symptoms that characterize a genetic disorder is a(n)______ . a. syndrome c. abn...

A: Genetic disorders are caused by genes.  

Q: Would the Meselson and Stahl experiment have workedif diploid eukaryotic cells had been used instead...

A: Meselson and Stahl are known for discovering the semiconservative mode of DNA replication. They perf...

Q: Which technique/s is/are used in DNA probe development? O CRISPR O ONA profiling OPOR O DNA recombin...

A: PCR  Species-specific probes have been developed. For example, specific DNA fragments specific to A....

Q: The process in which environmental pressures result in the differential survival and reproduction of...

A: Introduction  Evolution is the key process that regulates the survivability and continuity of specie...

Q: Dinosaurs like protoceratops how do they defend themselves from predators like velociraptors or othe...

A: Dinosaurs like protoceratops how do they defend themselves from predators like velociraptors or othe...

Q: Which of the following statements is most likely behaviorally when applied to a male primate with a ...

A: Introduction: When male and female individuals are distinguished externally, the phenomenon is calle...

Q: Which of the following perspectives focuses on the biological bases of universal mental characterist...

A: Introduction:- The human mind and behaviour can be explored from a variety of perspectives in psycho...

Q: 5

A: Recombinant forms of Oestrogen and Progesterone are used in post menopausal women. Recombinant insul...

Q: Why is leguminous crop rotation used in agriculture?

A: Introduction In this question we will discuss about why leguminous crop rotation is used in agricult...

Q: You are investigating the transport of proteins into the ER in various mutant cells. Where would you...

A: Transport into the endoplasmic reticulum (ER) is the important step inside the biosynthesis of maxim...

Q: Discussion on the challenges using the technology by touching the followings: • Technology challenge...

A: Diabetes It is a disease that is caused when the blood glucose level becomes too high. Blood glucose...

Q: What is a null hypothesis in experiments? How is a null hypothesis used in science experiments

A:

Q: A deer eats 25kg of herbaceous material per day. The herbaceous material is approximately 20% dry ma...

A: This food chain is an open system because this food chain exchange energy and with its surroundings.

Q: 45

A: Steps of Enchondral Ossification Cartilage > Bone Detailed sequence elucidated in part 2

Q: How will this modified cro protein interact with the three OR sites, and how would cro expression be...

A: Bacteriophages are viruses that infect bacteria. Like other viruses bacteriophages are also made up ...

Q: Photosynthesis in some of the crops is efficient at this range of temperature   a. 20°C - 30°C   ...

A: Photosynthesis is the process that produces organic matter from simple inorganic molecules, using su...

Q: In the absence of oxygen, the cell's ability to convert glucose into ATP is

A: Anaerobic respiration is sometimes is also known as fermentation, it is a metabolic process in which...

Q: Describe the deference between microbial contamination and microbial fermentation in milk?

A: Fermented or cultured milk is prepared by adding microbes like bacteria or moulds to the normal milk...

Q: a) give the definition to the «nitrogen balance» and whether or not it is changed in the patient; b)...

A: A)Nitrogen Balance is the difference between the Nitrogen intake and loss . If more nitrogen content...

Q: explain why we feel headache when we woke up late and not eating a breakfast before going to school.

A: *carbohydrate metabolism is s chemical process that supplies continuous energy to cells. * The major...

Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser ...

A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and ...

Q: Protoceratops how did they defend itself from predators? They hornless Dino and very small. So what ...

A: Protoceratops can be referred to as herbivorous dinosaur that possessed four limbs and was an ancest...

Q: Feral cats in Australia I read they are insaive species causing harm to wild life? What harm can the...

A: Feral cats are mainly untamed and unowned cats that mostly live in the wild and avoid socialization....

Q: What are the characteristics of small intestine epithelial cells and kidney epithelial cells observe...

A: Intestinal epithelial cells are the surface of intestinal epithelium, where they play important role...

Q: Mycobacteria tuberculosis and Rickettsia

A: Mycobacterium tuberculosis is a pathogenic that bacteria from the family Mycobacteriaceae and the ca...

Q: The energy available to do work in a cell is called: a. thermal energy b. potential energy c. ...

A: Introduction :  thermal energy - every objects has thermal energy.  It's the movement of molecules w...

Q: A breeder performed a testcross to find out if his male dog was a purebred black. He got one brown p...

A: Introduction :- An experimental hybrid between an individual organism with a dominant phenotype but ...

Q: How are enzymes classified? What are the different classes of enzymes?

A: Enzymes are biocatalyst that is proteinaceous in nature and perform a specific type of chemical reac...

Q: expalin how theory of evolution affects our view of the origin, developtment and spread of new disea...

A: The theory of evolution is based on the idea that all species are linked and evolve through time. Th...

Q: A broth culture is initially inoculated with a single bacterial cell. For the first hour the bacteri...

A: * Given that  The bacteria has generation time of 30 minutes. So it takes about thirty minutes to di...

Q: Match the sense orgs with the type of stinulus they are able to detect Ooo mouth (Choose) ight chemi...

A: Stimulus(plural)/Stimuli(Singular) Any change in an organism's environment that causes to the organi...

Q: At each origin of replication, DNA synthesis proceeds bidirectionally from two replication forks. Wh...

A: Introduction The process of replicating a double-stranded DNA molecule into two identical DNA molecu...

Q: Fish-for-self Thief Fish-for-self P-B FOCAL ANIMAL Thief P B-C P-C The above figure is a suitable ap...

A: The table shows the matrix of fitness.  P= baseline fitness  B= fitness by stealing C = fitness cos...

Q: If the global average temperature on Earth were to drop 6°C below the current value, what conditions...

A: Dropping of global temperatures by 6 degrees will eventually impact the world as follows: -     ...

Q: What will guide them to make the right decision?  Do they have a choice?

A: Answer: 1.trophobalst or icm if cells choose to become they will end up in the placenta and if they ...

Q: Black body (b) and purple eye (pr) are recessive autosomal mutations in Drosophila. Bridges are cros...

A: b - allele for black body - recessive pr - allele for purple eye - recessive B - wild type for body ...

Q: What are helicases and topoisomerases?

A: Enzymes are the proteins present in the cells and have catalytic powers.  

Q: Which of the following statements about potency is correct? A. Committed progenitors have more poten...

A: Multipotent stem cells have higher potency than pluripotent stem cells.

Q: What is the formula for net primary production (NPP)? How does NPP relate to energy pyramids?

A: Introduction :- The difference between the energy fixed by autotrophs and their respiration is preci...

Q: Given your knowledge of temperate biomes, why can temperate seasonal forests retain more of their so...

A: Biome refers to the community of flora and fauna with are like characters concerning the environment...

Q: What is Arthrobacter luteus ?

A: Prokaryotes are organisms with no well-defined nucleus.  

Q: A new intestinal isolate of E. coli is known to have a generation time of 12 minutes. If a culture c...

A: generation time is the time required by bacteria to multiply and become double.  bacteria has genera...

Q: There are two types of alleles: Type B1 and Type B2 (In total there are 10) Type B1 has 6 Type B2 ha...

A: Introduction : Here,  B1 allele = p = homogygous dominant allele              B2 allele = q = homogy...

Q: Both rhodopsin in vision and the muscarinic acetylcholine receptor in cardiac muscle are coupled to ...

A: Receptors receive the signaling molecules that bind to them.  

Q: Assign a genotype to each individual in generation II. 1 2 3 II 4 7 8 II 9 10 11 12 IV 13 Griffths, ...

A: Introduction: Human males carry single copy of X-chromosome and hence allow the expression of recess...

Q: How do retroviruses use the enzyme reverse transcriptase?

A: Retroviruses are the virus that contain RNA as its genetic material. Examples are HIV, HTV, Murine l...

Q: Another name for fiber is amylose O cellulose O pectins O Amylopectin

A: all plant fibers are constructed by few constituents such as cellulose, hemicelluloses, and lignin, ...

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.