hat will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5) If the base G (denoted by an asterisk) in the
Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first…
A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…
Q: While studying the structure of a small gene that was recently sequenced during the Human Genome…
A: The rule in the case of DNA indicating that there is always equality in quantity between the bases A…
Q: Bearing in mind the different number of hydrogen bonds that form between the two different purine-…
A: DNA and RNA are polynucleotides that are composed of a chain of nucleotide monomers with distinct…
Q: Which of the following sequences is most likely to form a beta-turn? Explain why?…
A: The majority of proteins are globular in form. Thus, forming, turning, bending, or reorienting is…
Q: Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules,…
A: DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) are two examples of nucleic acids. DNA and…
Q: What is the "pucker" conformation of deoxyribose in the B-form structure of DNA? C2-endo…
A: Sugar puckering :- geometry of ribose sugar have 5 endocyclic TIRTIONAL ANGLES.
Q: One of the key pieces of information that Watson and Crick used in determining the secondary…
A: A DNA molecule consists of two strands that wind around each other and each strand of DNA consist of…
Q: Why are there nucleotides (A, T, G, and C) in the master mix? What are the other components of the…
A: PCR is a technique that results in exponential amplification of a selected region of a DNA molecule…
Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…
A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…
Q: The compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with…
A: The given compound nitrous acid substitutes the cytosine(C) with uracil (U) and adenine (A) with…
Q: in the DNA of certain bacterial cells, 13% of the nucleotides are adenine. What are the percentages…
A: Deoxyribonucleic Acid (DNA) is a double-stranded, right-handed helical molecule that is twisted…
Q: Which of the following DNA sequence pairs are completely complementary?
A: The above given statement is about DNA complementary sequence.
Q: Z-DNA derives its name from the zig-zag conformation of phosphate groups. What features of the DNA…
A: There is various possible double helical structure of the DNA; Z-DNA is one of them. In Z-DNA, helix…
Q: If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence…
A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…
Q: f a DNA-binding protein “reads” a short stretch of DNA and detects the following “second” genetic…
A: In DNA, there are four nitrogenous bases namely, Adenine (A), Guanine (G), Thymine (T) and Cytosine…
Q: Please by using the first base of each as the first triplet in a condo, how do I translate two…
A: Translation Translation is the process in which the mRNA or messenger RNA is get translated. mRNA of…
Q: Which THREE of the following characteristics are the same in both DNA and RNA? A) deoxyribose sugar…
A: Nucleic acid are the macromolecules which are found in the cells or the viruses. It is of two types…
Q: Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids…
A: Lactose permease Its belong to transmembrane protein family. The transport mechanism of lactose…
Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…
A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…
Q: Consider the sequences (i-iv) that represent sections of a protein. i) -AEEAAAAMAAAAMAAY ii)…
A: Secondary structure is the formation of regular patterns through interaction between nearby…
Q: Which of the following (A through E ) would you expect to find in a nucleotide chain constructed for…
A: Sanger sequencing is the method developed to sequence the short sequence of nucleotides base pair in…
Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…
Q: Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA…
A: Ans - a.) 5’- G A G C G A T C G C T C - 3’ 3'- C T C G C T A G C G A G -5'…
Q: If one DNA segment has the following base composition, 5'-CAGTTAGC-3', which of the following…
A: Introduction : DNA or Deoxyribonucleic acid is the genetic material found in most living organisms.…
Q: What are the sequences of all the possible tripeptides that contain the amino acids, serine, leucine…
A: The polypeptide is made up of amino acid residues, which are joined by the peptide bond.
Q: Are the following base sequences “sticky” (complementary) or not? All sequences are written 5′ to…
A: The purines (adenine and guanine) and the pyrimidine (cytosine, thymine) are the two types of…
Q: If the amino acid sequences of monkeys and humans in the protein of two organisms are similar, why…
A: Amino acids Amino Acids are known as building blocks of proteins. There are many different kind of…
Q: 5'G-A-T-A-C-А-А-с-А-т-G-G-A-с-A-T-G-A-с-т3' What would be the first 3 bases in the 5' end of the…
A: In DNA four types of nitrogenous bases are found in which adenine (A) is complementary with the…
Q: Name and write the structures of the purine and pyrimidine bases present in DNA.
A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…
Q: A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5'…
A: Introduction Amino acids are molecules that combine to form proteins, They build muscles, prevents…
Q: Each of the following sequences has a total of 20 nucleotides (note that the first six are the same…
A: Introduction Stem-loop formation occurs in single-stranded RNA when two regions of the same strand…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: DNA is first transcribed into messenger RNA and then mRNA is translated into protein sequence.
Q: What is the melting temp. of the following double-stranded DNA fragment…
A: Melting temperature formula : Tm = 4* (G+C) + 2 * (A+T) Number of G+C = 6 Number of A+T = 20
Q: 1. For each of the sequences given below, list what type of secondary structural element, if any is…
A: Proteins are found in four structures namely: Primary which is a linear sequence of amino acids.…
Q: As pointed out in the text, you and a complete stranger are 99.9% identical in DNA sequence. But you…
A: Introduction: 99.9% genome similarity is present in humans and the remaining 0.1% is different. This…
Q: To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3',…
A: DNA: RNA hybrid are the structures that are formed between the newly synthesized RNA and the dsDNA.…
Q: What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read…
A:
Q: An exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide…
A: When snake venom phosphodiesterase cleaves a nucleotide from a nucleic acid strand, it leaves the…
Q: From the above sequence (DNA: ATGGATCCGCTTTAG), what is the amino acid sequence?
A: - Cells decrypt mRNAs by reading their nucleotides in teams of 3, known as codons. Here square…
Q: State the properties of the Watson-Crick model of DNA in the following categories: a) number of…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: Below is a sequence of DNA.…
A: Amino acids are the building blocks of proteins. The building blocks of life are amino acids and…
Q: The DNA from sea urchins contains about 32% A and about 18% G. What percentages of T and C would you…
A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that stores genetic information…
Q: E. coli has two tRNAs for methionine. What is the basis for the distinction between the two?
A: Protein is one of the macromolecules found in the body. Proteins are synthesized using the…
Q: Draw and label the following RNA tetranucleotide: 5'phosphoryl-A-2'O-methyl-C-U-G-3'- phosphate.
A: A tetranucleotide is sequence of four base pairs in RNA (ribose nucleic acid) is known as RNA…
Q: For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below…
A: Given: a sequence of amino acids, serine-valine-lysine-leucine
Q: Consider a three-base sequence in the template of DNA: 5' . . . 123 . . .3', in which 1, 2, and 3…
A: Here the 1,2 and 3 stand for the relative position of nucleotides . The mRNA sequence would be…
Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…
A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…
A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…
Q: In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share all but…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
- What will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5)
- If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5)
- If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5)
- What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)
Step by step
Solved in 2 steps
- AUU Isoleucine ACU AAU Asparagine AGU Serine U AUC Ile ACC |Threonine AAC AAA AAG Asn AGC Ser |AUA Methionine Lysine Lys AGA Arginine Arg ACA Thr A Met ACG AGG AUG Initiation codon GAU Aspartic acid GAC GCU GCC Alanine GCA GCG GUU GGU GỤC Asp GGC Glycine C G |GUA GUG Valine Val GAA Glutamic acid GAG Ala GGA Gly A Glu GGG G (a) What amino acid will a tRNA be carrying if its anticodon is GGG? Enter its 3-letter code. (b) What amino acid will a tRNA be carrying if its anticodon is UCC? Enter its 3-letter code. (c) What amino acid will a tRNA be carrying if its anticodon is UAU? Enter its 3-letter code. First letter ( Third letterUse the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterGiven the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
- mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…First letter U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC CAA CAG AAU AAC Histidine Glutamine Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC GGU GGC AGA AGG Arginine GGA GGG Arginine Serine UOAGUO AGUOAGUCAG Glycine Which mutation would result in a conservative substitution with potentially serious consequences to the translation of the mRNA and synthesis of the protein? Third letter(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterFirst letter U U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine A AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG C Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC A CAA CAG Histidine Glutamine AAU AAC Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC GGU GGC AGA AGG Arginine GGA GGG AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC Arginine Serine Glycine Which mutation could result in the removal of a site for glycosylation or phosphorylation? DOAGUO AGUO AGUAG Third letter с1. The UAU and UAC codons in MRNA both specify What feature of the genetic code explains this? Second letter C UUU Phenyl- UUC alanine UAU UAC UCU Tyrosine UGU UGC Cysteine UCC Serine UCA UUA UUG UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan Leucine UCG CAU CÁC CUU CUC CUA CUG CGU CGC CCU CC CCA CCG Histidine Leucine CGA Arginine CGG Proline CAA CAG Glutamine AUU AUC Isoleucine A AUA AAU AAC Asparagine AGU ACU ACC ACA ACG AGC Serine Threonine AAA Methionine; start codon AGA AGG Arginine AUG AAG Lysine GUU GUC GAU Aspartic GAC acid GCU G GUA GUG GCC Alanine GCA GGA Glycine GGG GGU GGC Valine GCG GAA Glutamic GAG acid Chp 米 144 Third letter UCAG UCAGUCAGU CAG First letter
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-CysRNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…