Question 3 -- / 1 What form(s) of chemical energy are generated during cyclic photo-phosphorylation? 1 NADPH and ATP 2 NADPH only 3 ATP only No chemical energy is generated during 4 cyclic photo-phosphorylation
Q: OH HO NH2 O Cceramide O Sphingosine O Globoside O sphingomyelin
A: Lipid metabolism is the synthesis and degradation of lipids in cells, which includes the breakdown…
Q: uan used the ABO blood testing kit to determine his blood type. His test showed the following…
A: ABO blood grouping in humans: The RBCs of the one with blood group A have antigen A and the plasma…
Q: THE TADLE DY REFERRING T OTHE STEP Name of Reaction Reactant Enzyme Product Phosphorylation Glucose…
A: Glycolysis is the catabolic pathway in which Glucose is broken down into 2 molecules of 3C…
Q: Question 20 он NH но HO" "он cerebroside monoglycosyl ceramide glycosphingolipid O all are correct
A: Phospholipids are compound lipids composed of fatty acids, alcohol, and an additional group. Based…
Q: A. Name the two proteins that induce a negative feedback in this pathway and explain why both…
A: Since, you have posted multiple questions we will solve the first question for you. If you want any…
Q: 1) If a mutation caused an alanine to turn in glycine, what kind of effect do you think that would…
A: Alanine: An aliphatic amino acid with methyl (-CH3) group side chain and is non-reactive side chain…
Q: QUESTION; — Compare and contrast the degradation pathways of purines and pyrimidines, making sure to…
A: Nucleotides are used in nucleic acid synthesis, intermediate metabolic processes, and the breakdown…
Q: Which of the polysaccharides WILL DECREASE GELLING if acid is added to the sample? pectins…
A: Gels are solid, jelly-like structures made of colloid polysaccharides, proteins, and polymers…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: It is known that 80% of Penicillin is protein bound. Explain how most of it is being cleared from…
A: Penicillin is an antibiotic and a beta lactam drug. Penicillin upon administration into humans , go…
Q: A. Lysine: Polar basic: Calcium absorption B. Proline: Nonpolar imino acid: Protein synthesis C.…
A: A. Lysine is basic, has R group that is significantly positively charged at pH 7. It has second…
Q: What are the different types of RNA? Where are these types located within the cell?
A: Introduction: The structure of RNA is made up of a repeating strand of nucleotides that contain all…
Q: Describe the ion dynamics of the muscle-contraction process.
A: Tension-generating regions within muscle cells are activated during muscular contraction. Muscular…
Q: In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form gluconolactone.…
A: A glucometer is generally a little, portable device that helps to monitor (glucose levels) at home.…
Q: A polypeptide is shown below. Please answer the following questions. OH В A C H;N E H D H a. Match…
A: A polypeptide is a long, unbranched chain of amino acids joined by peptide bonds. To generate an…
Q: In the Biuret Assay for protein concentration determination, the role of sodium potassium tartrate…
A: The biuret test is a chemical test that can be performed to determine whether an analyte has peptide…
Q: Which base compositions for single-stranded RNA are possible? %A %G %C %T %U OA. All of the answers…
A: RNA are single stranded, their nucleobases donot participate in base pairing. According to the…
Q: Tabulate the main structural features of DNA and RNA. In one sentence, point out the salient…
A: Nucleic acids are made up of nucleotides. Nucleotides are the monomer units of nucleic acid.…
Q: I. True or Flase a. An inhibitor may compete with the substrate for binding to the active site of…
A: Enzymes are proteins which act as biocatalysts. Enzymes increase the rate of biochemical reactions…
Q: Question 8 O alpa-palmitoyl-beta-stearoyl-alpha-oleoyl glycerol O…
A: Triacylglycerols (TAGs) are the stored form of lipids, which are composed of three fatty acids and a…
Q: Can you please help me answer the following question in three paragraphs and in your own words.…
A: Enzymes are substances that enhance the rate of chemical reaction and facilitate the formation of…
Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…
A: The qPCR is generally useful to determine the actual value of PCR product present at provided…
Q: 4. A solution containing egg albumin (pl-4.6), B-lactoglobulin (pl-5.2), and chymotrypsinogen…
A: Based on their isoelectric point, protein purification can be done in an ion-exchange column (pI).…
Q: Describe the basic features of the DNA double helix
A: DNA is Deoxyribo Nucleic acid . This is the biomolecule that is responsible for heredity in almost…
Q: 1. What are the three major pathways that eventually become entry points of molecules into the Krebs…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: I want a solution that is 1/10th the strength of my stock solution. I want 20 microliters of total…
A: A solution can be diluted to the desired concentration by using the formula C1V1=C2V2 Where C1=…
Q: Both reducing monosaccharide and disaccharide give positive result in Barfoed's test. Which of the…
A: Barfoed's test is done to differentiate between monosaccharide and disaccharide.
Q: b. Two different liposomes have radii of 50.00 nm and 70.00 nm respectively. In a biopolymer…
A: Introduction: Liposomes are simple microscopic vesicles in which aqueous volume is enclosed entirely…
Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…
A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…
Q: Arrange signalling cascade events in chronological order.…
A: Signaling pathways helps to respond the cells according to the external stimuli. The external…
Q: For the Complex III in the electron transport chain: Complex III step 1: UQH2 is oxidized in a 2…
A: In the question there are two separate processes mentioned Two electron process One Electron…
Q: The molecules of a fatty acid (for example, fit closer together than the molecules of a fatty acid…
A: Fatty acids are composed of a long hydrocarbon chain attached to a carboxylic acid group. Fatty…
Q: In Table 13-1, what is the most common function of proteins that contribute to pattern formation?…
A: Drosophila melanogaster, a fruit fly, is utilised as a model organism in research spanning from…
Q: 6. DNA electrophoresis uses polyacrylamide gel for separation. a) True b) False 7. Agarose is a…
A: DNA is composed of nucleotides attached via phosphodiester bonds. DNA act as genetic material in…
Q: separating gel
A: here they talk about ion exchange chromatography and electrophoresis. Ion exchange chromatography…
Q: What are the main structural features of an amino acid?
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They serves as building…
Q: Test Results + or -? Points awarded Code Glu – acidic end products yellow ______ _____+ Glu – gas…
A: Introduction: Microbial metabolic processes are complex but still, it permits the microbiologist to…
Q: Show the amount of ATP were produced in beta-oxidation of lauric acid, and differentiate both the…
A: Lauric acid has a 12-carbon backbone and is a saturated medium-chain fatty acid. Under anaerobic and…
Q: A man just ate a plant-based hamburger with a bun and nothing else on the sandwich.Coincidentally,…
A: As man ate plant-based hamburger with a bun. Plant based hamburger is made up basically from…
Q: Can someone please draw out phosphorylated creatine?
A:
Q: Kinesin-1 was the first member of the kinesin superfamily to be identified and therefore is perhaps…
A: Kinesin are one of the mejor cytoplasmic motors responsible for long range transport in all…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…
A: The reaction given in the problem is the reaction between Pyruvate to Lactate conversion which is…
Q: Match the each enzyme deficiency with their corresponding disease…
A: Different enzymes are required for synthesis of spingolipids. If these enzymes are not…
Q: Under what pH conditions can a protein not bind to the beads in a column? pH = -pKa pH =…
A: Proteins are composed of amino acids. There are a total of twenty standard amino acids that make up…
Q: 20. Beta-oxidation of fatty acids takes place at A. peroxisome B. mitochondria C. mitochondria and…
A: Beta oxidation of fatty acid - Process via which the fatty acids get broken down for energy…
Q: lycogen isolated from liver biopsy specimen had normal structure. Blood glucose level was below…
A: Introduction: Glycogen storage disease is a group of disorders that is characterized deposition of…
Q: 1. Is the Homo sapiens phenylalanine hydroxylase (PAH) gene encoding a non-coding protein or an…
A: Gene is a portion of the genome that can be transcribed or a functional unit of the genome…
Q: 7. Which of the following statement is true? A. oxidative rancidity is observed more frequently in…
A: Introduction: Rancidity is the development of unpleasant smells in fats and oils that is often…
Q: 4) Complete hydrogenation of TAG (Y) above would yield a TAG of what fatty acid composition?…
A: In the given table, fatty acid composition of three Tri-acyl Glycerol is given: TAG(X) =…
Step by step
Solved in 2 steps
- QUESTION 10 Mitochondria and chloroplasts differ in that O 1. mitochondria contain DNA, but chloroplasts do not O 2. chloroplasts contain DNA, but mitochondria do not. O 3. mitochondria harvest chemical energy, whereas chloroplasts convert light energy into chemical energy. O 4. mitochondria are enclosed within one membrane, whereas chloroplasts are enclosed within two. O 5. mitochondria have extensive infoldings of membrane, whereas chloroplasts do not have extensive internal membranes.QUESTION 10 Mitochondria and chloroplasts differ in that O 1. mitochondria contain DNA, but chloroplasts do not O 2. chloroplasts contain DNA, but mitochondria do not. O 3. mitochondria harvest chemical energy, whereas chloroplasts convert light energy into chemical energy. O 4. mitochondria are enclosed within one membrane, whereas chloroplasts are enclosed within two. O 5. mitochondria have extensive infoldings of membrane, whereas chloroplasts do not have extensive internal membranes. QUESTION 11 Plasma membranes are relatively impermeable to water-soluble molecules because O 1. the membranes are waxy. O 2. water molecules are nonpolar. O 3. their bilayer is comprised of phospholipids. O 4. they have salt crystals embedded within them. O 5. large proteins extend through both sides of the membranes.Question 1 -- / 1 Where does molecular oxygen (02) get generated during photo-phosphorylation? 1 Photosystem I 2 Photosystem II Cytochrome bf complex 4 Ferredoxin 3.
- Question 15 Which one of the following statements is FALSE? Oa ADP is often one of the products ofa reaction catalyzed by a protein kinase O Protein phosphatases usually release a phosphoryl group as inorganic phosphate Oc Protein kinases usually add a phosphoryl group from ATP to a Val, Leu, or lle Od An enzyme could be activated or inactivated by a protein kinase AMoving toanother question will save this response.Question 8 The major structural component of the exoskeletons of invertebrates is composed of N-acetyl-B-D-galactosamine joined by B-1,4-glycosidic bonds True FalseQuestion 5 An a-helix has the sequence: NH3-Ser-Glu-Gly-Asp-Trp-Gln-Leu-His-Val-Phe-Ala-Lys-Val-Glu- COO-. The carbonyl oxygen (in the peptide bond) of the W5 residue is hydrogen bonded to the amide nitrogen of H8 E2 O V9 O S1
- Question 38 Plant cells carry out photosynthesis to produce all of their ATP whereas animal cells carry out cellular respiration to produce all of their ATP. O True O False MacBook Pro esc 吕口 DII F1 F2 F3 F 4 F5 F6 F7 F8 1 3 4 Q W Y А F J ck Z C V 00 T %24Question 12 One of the targets of CDK is a phosphatase. What effect does the phosphorylation of this phosphatase have during the transition through the cell cycle? CDK is dephosphorylated as part of a positive CDK/cyclin feedback mechanism. O CDK is dephosphorylated as part of a as part of a negative CDK/cyclin feedback mechanism. O CDK is phosphorylated as part of a part of a negative CDK/cyclin feedback mechanism. O CDK is phosphorylated as part of a positive CDK/cyclin feedback mechanism.QUESTION 9 Which of the following is/are found in prokaryotic cells? O 1. Mitochondria O 2. Chloroplasts O 3. Nuclear membrane O 4. Ribosomes O 5. Endoplasmic reticulum QUESTION 10 Mitochondria and chloroplasts differ in that O 1. mitochondria contain DNA, but chloroplasts do not O 2. chloroplasts contain DNA, but mitochondria do not. O 3. mitochondria harvest chemical energy, whereas chloroplasts convert light energy into chemical energy. O 4. mitochondria are enclosed within one membrane, whereas chloroplasts are enclosed within two. O 5. mitochondria have extensive infoldings of membrane, whereas chloroplasts do not have extensive internal membranes.
- QUESTION 15 Which of the following molecules is NOT a component of desmosomes? A Intermediate filaments B Actin C Plakoglobin D Desmoplakin E DesmocolinQuestion 6 When light hits the special light-reactive molecular units inside rod cells, how do these units respond? They break in half and float into the eye's vitreous humor One bond shifts positions from cis to trans orientation they form a dehydration synthesis reaction with neighboring units, forming cross bridges O they open Na+ channels which rush into the cell Question 7 Which of the following about eyes is NOT RIGHT? O Spiders have image forming eyes O Sea Stars have eye spots O some compound eyes in arthropods have tiny lenses O cephalopods evolved eyes from early vertebratesQuestion 1 - Photosynthesis lab Four common plant pigments are likely to be separated and visualized by the paper chromatography experiment. List the expected colors of each of these four pigments below.A) CaroteneB) Chlorophyll aC) Chlorophyll bD) Xanthophyll Explain the mechanism of how floating disks correspond to the rate of photosynthesis. List 2 controlled variables in the leaf disk assay List 2 manipulated variables in the leaf disk assay What is the purpose of adding baking soda to the leaf disk assay? What would you expect during the leaf disk assay if baking soda was not added at all?