PYK gene codes for the expression of pyruvate kinase, which is one of the enzymes targeted for anti-cancer drug design. You have identified an RNAi that targets the mRNA of PYK gene. To study the effect of the RNAi towards pyruvate kinase, the respected
Q: Phorbol esters have been observed to induce the transcription of AP-1–influenced genes. Explain how…
A: Signal transduction is a process in which signals from the extracellular level enter the…
Q: a. Panels G, H, and I show pattters wher fluorescence is detected in the cytosol or internal…
A: In the panels G, H, and I, the same β5 subunit of G protein is associated with different γ subunits.…
Q: Cancers are often caused by overactive growth factor receptor signaling (remember growth factor…
A: Cancer is a disease which is caused by the uncontrolled growth of the cells, without regulation of…
Q: After the initial Actualization of the Cit+ phenotype, there was another alteration to the A-3…
A: Bacteria are dynamically evolving microbes. Various experiments suggest the evolution process of…
Q: In the galactose operon of E. coli, a repressor, encoded by the galR gene, binds to an operator…
A: The galactose operon of E.coli is called as gal operon. This operon consists of 4 structural genes.…
Q: In tumor cells obtained from patients with Burkittlymphoma, a cancer of the immune system’s B…
A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…
Q: Now read this abstract from a 2013 journal article What is the authors' explanation of how Gal80p…
A: In the present system, GAL genes in Saccharomyces cerevisiae are regulated by the combined action of…
Q: Proteins that are retained in the ER have a KDEL sequence at their C-terminus. To test the idea…
A: Protein disulfide isomerase,, is an enzyme in the endoplasmic reticulum (ER) in eukaryotes that…
Q: A knockout mouse with an ablated PRNP gene is injected with exogenous prions. Which of the following…
A: Option e Spongiform transformation of brain
Q: Using baker's yeast it is possible to generate point mutations that destroy the kinase activity of…
A: Polyadenylation is a process of adding poly A tail to pre- mRNA.
Q: Expression of ---- does not require new protein synthesis. a.immediate early genes b. delayed…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been…
A: The codons are the triplet sequences of the nucleotides like DNA (deoxyribonucleic acid) and RNA…
Q: ''The chemical carcinogen dimethylbenz[a]anthra-cene (DMBA) must be an extraordinarily specific…
A: Abnormal growth of skin cells when exposed to sunlight causes skin cancer. They are originated from…
Q: Predict and explain the effect on GAL1 transcription, in the presence of galactose alone, of the…
A: Note: Hi! Thank you for the question. As per the honor code, we are allowed to answer three…
Q: RNAi is currently being tested as a therapeutic tool for genetic diseases and other conditions.…
A: RNA interference or Post-Transcriptional Gene Silencing is a simple and rapid method of silencing…
Q: In an E. coli mutant, beta galactosidase and permease are expressed at high levels when both glucose…
A: In normal condition, when lactose level is high and glucose level is low, galactosidase and permease…
Q: Briefly describe how the cyclin D-cdk4/6 and cyclin E-cdk2 complexes regulate Retinoblastoma protein…
A: Retinoblastoma is the disease occurring in the retina of the eyes. This is basically eye cancer…
Q: . Cells containing missense mutations in the crp gene(encoding the positive regulator CRP) are Lac−,…
A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…
Q: RTK pathway leading to the phosphorylation of Rb to form p-Rb.
A: Receptor tyrosine kinase pathway helps in regulation of embryonic development aspects. Extracellular…
Q: When activated by ligand binding, the PDGF (platelet-derived growth factor) receptor becomes…
A: The SH2 domains of cytoplasmic signaling proteins bind to autophosphorylated growth factor…
Q: Aberrant signaling through the Ras-BRaf-MAPK signal transduction pathway drives many cancers. This…
A: Ras-BRaf-MAPK signal transduction pathway is well characterized pathway and known to transduce…
Q: Notch is an important transmembrane receptor that is present on the plasma membrane. Curiously, it…
A: Introduction When Exposed To Light In The Blue To Ultraviolet Range, The Green Fluorescent Protein…
Q: How does the activity of human p53 get regulated through the interaction of the transactivation…
A: p53 is basically a transcription factor that helps in suppressing the growth of the tumor. This…
Q: What effect does binding of the IRF protein to the IRE in the mRNA encoding ferritin have on the…
A: Iron regulatory proteins(IRP) are previously known as IRF or IRE-BP. They plays a major role in iron…
Q: "Schematic outline of melanogenesis. UVR stimulates the expression of POMC by keratinocytes. The…
A: Melanogenesis is the chemical pathway through which natural pigments known to be melanin pigments…
Q: The output of RTK pathways is often the activation of MAP Kinase. Explain how MAPK can lead to…
A: There are many intercellular signaling pathways processing in the cells. RTK pathway is a…
Q: Signaling pathways often require receptor dimers to become active. What would be an advantage of the…
A: Most receptors dimerize during their association with their ligands. This dimerization provides them…
Q: Hac1 is another chaperone protein that is up-regulated in response to unfolded proteins in the ER.…
A: Introduction Proteins are essential biomolecules that play a wide range of roles in controlling…
Q: . An interesting mutation in lacI results in repressorswith 110-fold increased binding to both…
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: An abundance of misfolded proteins in the ER can result in the activation of the unfolded-protein…
A: Endoplasmic Reticulum can be referred to as one of the organelles of cell that can be observed in…
Q: Which of the following mutations would produce a form of the Ras protein that would be more…
A: Ras is a type of very low molecular weight G-protein which takes part in various cell proliferation…
Q: Human histone H1 protein has the protein sequence as shown as “KKASKPKKAAS-…
A: Histone H1 protein K in the sequence represents lysine The given histone sequence is rich in lysine…
Q: Describe the various post-translational modifications of HIF- 1alpha and how it affects the…
A: Describe the various post-translational modifications of HIF- 1alpha and how it affects the…
Q: a. Would you expect a cell to continue or to stopdividing at a nonpermissive high temperature if…
A: The normal genes have various forms that can grow normally at low temperature and have an abnormal…
Q: When challenged with a low oxygen environment, knownas hypoxia, the body produces a hormone called…
A: DNA (deoxyribonucleic acid) is wrapped around proteins (known as histones) to form a structure known…
Q: Which statements are true? Explain why or why not.1 The chemical carcinogen…
A: Introduction: Cancer is the most common disease in the developing world and approximately one in…
Q: Relative to each promoter, where would you predict phosphorylated OmpR would bind the ompC and ompF…
A: EnvZ/OmpR are a part of a two-component regulatory system extensively found in bacteria and it has…
Q: Expression of the muscle specific protein dystrophin is important in the functional formation of…
A: Dystrophin is a protein which is essential for the proper contraction of muscles and it is found…
Q: Certain hormones, such as epinephrine, can increase the levels ofcAMP within cells. Let’s suppose…
A: EMSA electrophoretic mobility shift assays is an in-vitro method of analysis.
Q: Searching the yeast Saccharomyces cerevisiae genome, researchers found approximately 4,000 DNA sites…
A: Solution There are 4,000 possible sites in the yeast genome where Gal4 can bind, but, after the…
Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation,…
A: This is a nucleotide sequence of a DNA as it contains four types of nitrogenous bases Adenine,…
Q: Proteolytic cleavage of GLI, a transcription factor in the Hedgehog pathway, is important to…
A: To find Which of the following would promote proteolytic cleavage of GLI
Q: Suppose that a new mutation lacIes, ('es' stands for ‘extra-strength’) has been discovered…
A: Operon is the prokaryotic gene regulatory system that involves production of polycistronic mRNA.…
Q: One important role of Fas and Fas ligand is to mediate the elimination of tumor cells by killer…
A: Fas and Fas Ligand are two molecules that regulate of cell death. Their interaction is responsible…
Q: While investigating the function of a specific growth factor receptor gene from humans, researchers…
A: Growth factors work by engaging with certain cell surface receptors to control cellular…
Q: Using baker's yeast it is possible to generate point mutations that destroy the kinase activity of…
A: Thank you for the question Answer Gene expression is regulated by Cyclin depended protein kinase 9…
Q: Describe the role of pH in regulating the interaction between mannose 6-phosphate and the M6P…
A: The term pH stands for hydrogen potential. It is been stated that they are defined to decide whether…
The PYK gene codes for the expression of pyruvate kinase, which is one of the enzymes
targeted for anti-cancer drug design. You have identified an RNAi that targets the mRNA
of PYK gene. To study the effect of the RNAi towards pyruvate kinase, the respected RNAi
is expressed in Saccharomyces cerevisiae. The level of pyruvate kinase can be detected
with a fluorescent antibody.
(a). Predict the result that you will obtain in recombinant S. cerevisiae that expresses the
respected RNAi.
(b). Compare the result in Q3a(i) with the wild-type S. cerevisiae.
Step by step
Solved in 2 steps
- Aberrant signaling through the Ras-BRaf-MAPK signal transduction pathway drives many cancers. This makes the pathway an attractive drug target, and many small molecules have been developed that target either Ras, BRaf or MAPK. In malignant melanoma, one mutation in particular, where valine 600 of Braf is mutated to a glutamic acid (V600E), is found in the majority of cases. This mutation makes BRaf activation independent of upstream Ras activity. Would a small molecule that targets Ras be effective in a melanoma case driven by Braf V600E? Explain your answer.Certain hormones, such as epinephrine, can increase the levels ofcAMP within cells. Let’s suppose you pretreat cells with or withoutepinephrine and then prepare a cell extract that contains theCREB protein.You then use an electrophoretic mobility shift assay to analyzethe ability of the CREB protein to bind to a DNA fragmentcontaining a cAMP response element (CRE). Describe what theexpected results would be.RNAi is currently being tested as a therapeutic tool for genetic diseases and other conditions. Consider the following: cystic fibrosis caused by loss of function of the CFTR gene, HIV infection, and cancer caused by hyperactivity of a growth factor receptor. Which of these may be treatable by RNAi, and which not? Explain your reasoning.
- Measure the uptake of leucine by epithetial cells of the mouse intestine. Measurements of the rate of update of L-leucine, D-Leucine, and L-valine , with and without Na+ in the assay were perform and yield different results (see table below). A) What can you conclude about the properties and mechanism of leucine transporter? B) Would you expect L-leucine uptake to be inhibited by Ouabain, which is a cardiac glycoside drug treatment?Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a transcription factor. You have identified a novel variant in WT1: Arg422Pro. You have control cells and cells that have been engineered to carry the homozygous WT1 p.Arg422Pro mutation. You want to assess effects of this mutation on a variety of endpoints. For each endpoint listed below, choose the one technique is best suited to answer the question. Choose from: array CGH, qRT-PCR, qPCR, RNA-seq, FISH, in situ hybridization, western blot, immunostaining, WT1 ChIP-seq, WT1 ChIP-PCR, ATAC-seq, 3C Endpoint Technique? WT1 protein amount (quantitative) Western blot WT1 protein binding to all enhancers, genome-wide Chip-seq WT1 mRNA amount (quantitative) WT1 protein subcellular localization Quantitative assessment of all mRNAs in these cells (genome-wide) RNAseq Chromatin interactions between a specific WT1 chromatin binding site (identified above)…When challenged with a low oxygen environment, knownas hypoxia, the body produces a hormone called erythropoietin(EPO), which then stimulates red blood cell production tocarry more oxygen. Transcription of the gene encoding EPO isdependent upon the hypoxia-inducible factor (HIF), which is atranscriptional activator. However, HIF alone is not sufficientto activate EPO. For example, Wang et al. (2010. PLOS ONE 5:e10002) showed that HIF recruits another protein called p300to an enhancer for the EPO gene. Furthermore, deletion of p300significantly impaired transcription of the EPO gene in responseto hypoxia. Given that p300 is a type of histone acetyl transferase,how might p300 influence transcription of the EPO gene?
- Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulation of HIF-1al pha signaling. How might HIF- alpha alter the tumor microenvironment to promote tumor growth? Propose a strategy to prevent HIF-alpha signaling in the TME. What do you think would happen in a transgenic mouse with a total knockout of HIF-alpha?Cancer-promoting mutations are likely to have different effects on the activity of proteins encoded byproto-oncogenes than they do on proteins encodedby tumor-suppressor genes. Explain.Briefly describe the following properties of the Ras GTPases: a) Size, structure and cellular localization (for structure I want to know if they are lipidated and any other unique features) , b) How are they activated and inactivated (i.e. include the GEFs and GAPs), c). Give an example of downstream effector proteins, d). Are they or could they be involved in human cancer.
- The exchange of materials between RPE cells and the rods and cone cells is very important. Suggest by which membrane transport methods ions, proteins and damaged fragments of rod cells would be taken into the RPE cells. Outline the properties of stem cells which will help to repair the RPE layer of a patients retina after implantation of the thin sheet of cells. Outline how the presence of a base substitution mutation in the ABCA4 gene would result in the synthesis of a protein which cannot carry out its normal function. Need short answer in text solution and ASAP .5) Briefly explain why the formation of a tumour can pose a risk to a person's homeostasis. 6) The functioning of the "Ras/MAPK" signal transduction pathway is absolutely essential in order for cells to grow, divide, and migrate. One important protein that is part of this pathway is BRAF. This protein is a kind of enzyme called a "kinase" – an enzyme that transfers a phosphate group onto another protein. In some melanomas, a mutated form of BRAF called BRAF Val600AGlu drives the progression of the cancer. The drug "vemurafenib" slows the progression of the cancer by slowing the production of the mutant BRAF protein. (National Cancer Institute. 2019. Types of Cancer Treatment. Retrieved from: https://www.cancer.gov/about-cancer/treatment/types/ Is this an example of a traditional cancer therapy or a targeted therapy? Briefly explain your reasoning in the space provided, using information provided in the text to support your answer. Type of therapy (traditional or targeted)?: Brief…The output of RTK pathways is often the activation of MAP Kinase. Explain how MAPK can lead to activation of a specific subset of proteins, leading to distinct effects in different cell types in response to the same growth signal.