Polycistronic mRNA are common in bacteria but seldom occur in eukaryotes. Describe the key differences in mRNA structure and subsequent translation that support this observation. Answer in 250 words and cover all parts.

Polycistronic mRNA are common in bacteria but seldom occur in eukaryotes. Describe the key differences in mRNA structure and subsequent translation that support this observation. Answer in 250 words and cover all parts.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.3: Transcription

Problem 7LO: Compare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural...

See similar textbooks

Related questions

Q: If a community is concerned about finding out how nearby hydrologic(fracking) for gas has affected…

A: Paramecium and Euglena are both types of single-celled organisms that can serve as bioindicators in…

Q: Question 20 Which of these statements describes the activity of fast, fatigable (FF) motor units? FF…

A: The correct answer is: FF motor units generate a smaller maximum force than fast, fatigue-resistant…

Q: Pine forests tend to have a closed canopy of one or more pine species and relatively little…

A: In research or scientific studies, various types of variables are used, like dependent variables,…

Q: Which of the following is false? Options: tRNAs are heavily processed but in a manner that is…

A: RNA processing is a crucial aspect of gene expression regulation in eukaryotic cells, involving…

Q: What is the endocrine system? What is it for? What is the lymphatic system? What is the main purpose…

A: The human body is an individual's structural makeup. It is made up of numerous cell types that…

Q: Q1: Describe Intercalated discs and gap junctions in your own words and explain what is the function…

A: Muscle is a type of tissue found in the body of animals. They are specialized for contraction and…

Q: If your hospital laboratory isolates streptococcus pneumoniae from four patients on the same day,…

A: In the context of clinical microbiology, the isolation of Streptococcus pneumoniae from multiple…

Q: Spirograph B is from an asthmatic, Spirograph C is from a patient with emphysema. b. Spirograph B…

A: Spirometry is known to be the most commonly performed noninvasive test method for determining lung…

Q: Decribe Brown’s large granivore experiment and what was his hypothesis (Chapter 13)? Why did Brown’s…

A: Brown's large granivore experiment takes center stage, investigating the ecological dynamics…

Q: An individual who has voluntary facial paresis has aberrations in…? Group of answer choices The…

A: Facial paresis, also known as facial paralysis, is a condition where there is loss of facial muscle…

Q: What kinds of tool artifacts were found in the cave near Denisovan specimens? A. Lithic…

A: The question is asking about the types of tool artifacts that were discovered in the cave where…

Q: A 48-year-old man with a longstanding history of chronic constipation complains of anal itching and…

A: The objective of the question is to identify the most likely diagnosis for the patient's symptoms.…

Q: For E. coli, what is the source of energy, carbon, electrons, and identify the likely terminal…

A: Escherichia coli, commonly known as E. coli, is a Gram-negative, rod-shaped bacterium that belongs…

Q: A 79-year-old man presents with a history of extensive ulcers on both legs for 4 years. A photograph…

A: The objective of the question is to identify the correct diagnosis for a 79-year-old man who has…

Q: 1) Describe the change of Cis-aconitate to Isocitrate.

A: Since you have asked multiple questions, we will answer the first question for you. If you want any…

Q: sure of the sugar G3P? a. Light energy directly provides energy to RuBP and CO2, which produce G3P…

A: Photosynthesis is a process by which green plants prepare their own food in the form of glucose with…

Q: Which of the following is not a character/structure seen in amphibians? -scales -post-anal tail…

A: Amphibians are living organisms that survive on both land and water. A frog is an example of and…

Q: What is potentially the first example of art in the world? A. A cave painting of stars at night…

A: We investigate possible contenders for the world's first artistic expressions as we investigate the…

Q: A new beneficial mutation arises in a population of bacteria (haploid microbe) with a population…

A: Mutation refers to a change in the nucleotide sequence of the DNA contained in the genome of an…

Q: Why was it significant that the bones were found to be articulated (their bones hadn’t separated…

A: The significance of finding articulated bones (bones that haven't separated from each other) lies in…

Q: What is the best description of Venous circulation and arterial circulation

A: The circulatory system, a complex network of blood vessels and the heart, plays a vital role in…

Q: A mutation in the sodium voltage gated channel in which the inactivation gate closes more slowly but…

A: These questions delve into the intricate workings of neuronal communication, specifically focusing…

Q: Which is NOT correct about HPV? It establishes life long latency in the sensory neuron ganglia It is…

A: The question is asking us to identify the incorrect statement about Human Papillomavirus (HPV).

Q: What are the main events of the post absorbtive state?

A: The postabsorptive state, too known as the fasting state, is a metabolic period that happens when…

Q: Explain the mechanism through which the hemoglobin oxygen dissociation curve changes in exercising…

A: The hemoglobin oxygen dissociation curve is a graphical portrayal that represents the connection…

Q: The center solid curve represents the oxygen dissociation of hemoglobin, pH, Oxyhaemoglobin (%…

A: It has been asked about the Bohr impact, a physiological phenomenon that portrays how hemoglobin's…

Q: 1. Which type of cell division (mitosis or meiosis) results in: Cells Haploid cells Diploid cells…

A: Mitosis is type of cell division in which DNA of cell nucleus is split into two equal sets of…

Q: What increased proportionately more with moderate exercise, TV or breathing rate (frequency of…

A: Identify the change in tidal volume (TV) and breathing rate.Tidal volume (TV) increased from 500 mL…

Q: Which of the following is not a hitrogenous base? Amine Guanine Cytosine Adenine Thymine 00

A: A non-competitive inhibitor is a type of enzyme inhibitor that binds to an enzyme at a location…

Q: Which of the following is a unique attribute of CRISPR/Cas9 compared to restriction enzymes Group of…

A: The objective of the question is to identify the unique attribute of CRISPR/Cas9 compared to…

Q: An individual who has voluntary facial paresis has aberrations in…? Group of answer choices The…

A: The disorder known as voluntary facial paresis is characterised by the weakening or paralysis of the…

Q: What is the role of sulphuric acid in Molisch's test? Dehydrating agent O Color production Reducing…

A: Sulfuric acid is used in Molisch's test to break down carbohydrates into smaller molecules.…

Q: Which sea urchin larvae below is best suited for tropical waters? A Ο Α B

A: The spongy, globular Echinoderms belong to the class Echinoidea known as sea urchin. They are…

Q: Complete the following table outlining the products consumed and released by the following…

A: Autotrophs are organisms that can produce their own food from the substances available in their…

Q: A 65-year-old man presents with a 2-week history of abdominal discomfort. Physical examination…

A: The objective of the question is to identify the most likely underlying cause of the patient's…

Q: Opponents of alternative and renewable energy technologies argue that such technologies are…

A: The two articles, one from the American Enterprise Institute (AEI) economist.com and one from the…

Q: Question 16 Which type of neuron activates striated muscle fibers to cause muscle contraction? Upper…

A: The correct answer to the given question is Alpha motor neurons.The final shared pathway for motor…

Q: Mannitol salt agar questions www microbe C microbe A microbe B 1. Which of these microbes would best…

A: The questions asked about the use of Mannitol Salt Agar (MSA) in microbiology. MSA is a selective…

Q: Spirograph _____ shows hyperpnea and return to normal breathing following exercise. Spirograph…

A: Hyperpnea is an increase in respiratory rate and depth. It is typically caused by exercise or other…

Q: what is exercise? write an evaluation of your physical activity level. How much are you exercising…

A: In this context, investigating individual exercise propensities, comparing them to prescribed rules…

Q: What effect would a bilateral lesion to the amygdala have on a person?

A: The amygdala, a complex structure within the brain, plays a pivotal role in the processing of…

Q: 1. What increased proportionately more with moderate exercise, TV or breathing rate (frequency of…

A: Identify the change in tidal volume (TV) and breathing rate.Tidal volume (TV) increased from 500 mL…

Q: Which part of the neuron provides insulation for the neurons, to prevent the loss of charged ions…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: (Theme 5) AraC is a transcriptional activator that binds to the AraC binding site and is encoded by…

A: The introduction of arabinose into the bacterial culture serves as a trigger for the activation of…

Q: Suppose the DNA of a gene contains seven regions, A through G, in that order. Regions A, B, E, and G…

A: RNA splicing is a crucial step in gene expression, that enables the production of diverse proteins…

Q: Label both the h&e staining and the Masson trichrome

A: Hematoxylin and Eosin (H&E) stain and Masson’s Trichrome stain are both broadly utilized in…

Q: What are 3 causes of black sikatoga in banana plants. Additionally, state which one of the…

A: Black Sigatoka, is a devastating disease affecting banana plants. Understanding the underlying…

Q: draft details/ contents for a physiology presentation on microcytic anemia

A: Microcytic anemia is a type of anemia characterized by the presence of abnormally small red blood…

Q: Complete the following paragraph describing the advantages and disadvantages of allosteric…

A: Enzymes, the biological catalysts, are regulated by two essential mechanisms: allosteric regulation…

Q: How does carbon monoxide affect white blood cells and plasma?

A: In the realm of environmental and occupational health, the effects of carbon monoxide (CO) on the…

Question

Polycistronic mRNA are common in bacteria but seldom occur in eukaryotes. Describe the key differences in mRNA structure and subsequent translation that support this observation. Answer in 250 words and cover all parts.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: describing mRNA

VIEW

Step 2: describing eukaryotic and prokaryotic organisms

VIEW

Step 3: Describing cistron

VIEW

Solution

VIEW

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Compare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural differences.
The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference between these two types of cell and suggest two reasons why eukaryotic mRNA needs to be modified before translation.
Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'
For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.
Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'
Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the MRNA sequence below: UAACUAAGGAUGUAGUUAUG
Consider the following tRNAs, where the numbered forms represent the amino acids associated with them, answer briefly: PICTURE Question 1: The numbering indicates the order in which these tRNAs are recruited to the A site of the ribosome. Write the sequence of the mRNA being translated in the 5' - 3' direction Question 2: What is the amino acid sequence of the produced polypeptide? Question 3: Researchers discover that a mutation is in the anticodon of the gene encoding the proline tRNA of an individual. The anticodon sequence is normally 3' GGA 5', but in this individual the anticodon sequence is 3' GGG 5'. It appears that this individual suffers no adverse consequences. How can this be? (2 response items)
Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. 1. How many codons are represented in this oligonucleotide? 2. If the second G were changed to a C, what would be the resulting amino acid
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
draw mRNA sequence for the following sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG