Suppose the DNA of a gene contains seven regions, A through G, in that order. Regions A, B, E, and G are located in exons, while regions C, D, and F are located in introns. What is the order of the regions in the mature mRNA transcribed from that sequence that is used in synthesizing a polypeptide? A, ABCDEFG B, ABEGCDF C, CDF D, ABEG

Suppose the DNA of a gene contains seven regions, A through G, in that order. Regions A, B, E, and G are located in exons, while regions C, D, and F are located in introns. What is the order of the regions in the mature mRNA transcribed from that sequence that is used in synthesizing a polypeptide? A, ABCDEFG B, ABEGCDF C, CDF D, ABEG

Name: QUESTION 3? Question 3Suppose the DNA of a gene containsseven regions,
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: QUESTION 3? Question 3Suppose the DNA of a gene containsseven regions, A through G, in that order.Regions A, B, E, and G are located inexons, while regions C, D, and F arelocated in introns. What is the order of theregions in the mature mRNA transcri

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 26CTQ: Chronic lymphocytic leukemia patients often harbor nonsense mutations in their spliceosome...

See similar textbooks

Similar questions

Question 28 Introns Protein-coding sequences that need to be excised B Non-coding regions that need to be excised Protein-coding sequences that form part of the mature MRNA Non-coding regions that form part of the mature MRNA Question 29 Anomers are A Either the open chain structure or the cyclic structure, established through mutarotation B) Either L or D Cyclic monosaccharides that differ only in the positions of substituents at carbon (alpha or beta) The fifteen other stereoisomers of glucose Question 30 The nuclear lamina A is the site of ribosomal RNA (FRNA) synthesis maintains the shape of the nucleus encloses the nucleus to separate it from the cytoplasm D) regulates the entry and exit of molecules from the nucleus
Question 4 The stages of transcription includes the followings except RNA processing O initiation O elongation O termination
QUESTION 7 UUUUU..3' Rho-independent (intrinsic) terminators in bacterial transcripts consist of a sequence that forms a "hairpin" stem-loop structure, followed in the direction of transcription by a polyuridine (polyU) sequence, as shown in the figure above. Which of the following template strand DNA sequences, when transcribed, will form a terminator structure in the transcript? 5 CCGACGTATCCGACGTTTTTTTT3' 5'AAAAAAAACCGACGTATCGTCGG3' 5 CCGACGTATCGTCGGAAAAAAAA3' 5 TTTTTTTTCCGACGTATCGTCGG3' 5 AAAAAAAACCGACGTATGCAGCC3'
Question 7. What are the first three amino acids in the protein that is produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGATGGCTAGT... 3' 3' СТААGGCAТААTGTCGTATСCGATATAAGTGCACCTАCCGAТСА. .. 5' Start site
Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 3' 5' GATTCCGTATTACAGCATAGGCTATATT CACGTGGATGGTCAGTA... 3' CTAAGGCATA ATGTCGTATCCGATATAAGTGCACCTA CCGATCAT... 5' Start site
Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATT CA CGTGGATGGTCAGTA... 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCTACCGATCAT... 5' Start site
Question 7 The extent to which a given gene is transcribed depends upon (A the single transcription factor bound to the transcription start site (B the combination of translational factors bound to its upstream regulatory elements the particular combination of transcription factors bound to its upstream regulatory elements D the particular combination of transcription factors bound to its downstream regulatory elements
QUESTION 9 Which of the following step is NOT involved in eukaryotic MRNA synthesis? O Elongation O Polyadenylation O Rho-dependent termination Splicing Capping
Question 23 Which of the following is not part of pre-mRNA processing in eukaryotes? a Addition of a 5’ cap b Excision of introns c Addition of a 3’ poly-A tail d Excision of the promoter
Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCATGCGAT 5' Start site
Question 5 If an mRNA has the sequence 5'--AUGGUGUUA--3' what is the sequence of the coding DNA strand? Please input just the letters with no other marks. ATGGTGTTA 1 pts
Question 9 Both conservative and replicative transposition result in movement of the transposon; however, only conservative transcription Group of answer choices A. Transfers the transposition to the new location without copying it B. Has transposase that cuts at inverted repeats and target sequences C. Produces a second copy of the transposon sequence D. Inserts the transposon sequence into target sequences