Q: A TRNA molecule with the anticodon UGC would be carrying the amino acid: Second base of codon…
A: tRNA brings its amino acid to the mRNA in a specific order. This specific order can be determined by…
Q: includes
A: A new Covid, known as serious intense respiratory disorder Covid 2 (SARS-CoV-2), is the aetiological…
Q: List anticodon sequences on the tRNA’s carrying the amino acids: Ala, Phe, Leu, Tyr
A: In the process of translation, the mRNA-carrying codons are coded into the anticodons, which help to…
Q: threonine, alanine, and isoleucine. The TRNA anticodons for the amino acid sequence shown above is…
A: Protein synthesis or translation process takes place on the ribosomes with the help of messenger RNA…
Q: Isoleucine is encoded by three codons (5')AUU, (5')AUC, and (5')AUA. These three codons are…
A: Wobble hypothesis: This hypothesis was given by Francis Crick. According to this hypothesis the…
Q: Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the…
A: During Protein synthesis or translation that occurs in ribosomes, messenger RNA code for an amino…
Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…
A: Polypeptides are amino acid chains that forms the various protein molecues in our body. These…
Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5
A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…
Q: Order of bases in DNA Order of bases in MRNA (codon) AUC Order of bases in tRNA TAG Amino acid coded…
A: Amino acids are the smallest monomers which are known to form the polypeptide sequence of the…
Q: Write the names of the appropriate regions on L-shaped structure of TRNAS. 13' 15'
A: The process of protein synthesis involves transcription and translation. In transcription, DNA is…
Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…
A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…
Q: For each codon below, give the tRNA anticodon. 3. UUC 4. AUC 5. CCG 6. CGU
A: Anticodons are the three complementary bases present on the tRNA. On the basis of the anticodon, the…
Q: Which amino acid would be attached to a tRNA that read "GGU"? Val (M) Ala (A) Ser (S) 3'- Arg (R) A…
A: Amino acids are the structural unit of proteins, that is made up of carbon, hydrogen, Oxygen and…
Q: How many unique polypeptides would you expect to see synthesized by an in vitro translation reaction…
A: The correct answer is Option B - 1 According to the question, the mRNA code is poly (AC)n This…
Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…
A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…
Q: An anticodon on a TRNA has the sequence 3' UAC 5. What amino acid would it be charged with?
A: The tRNA is the transfer ribonucleic acid and it helps to decode the information present in the mRNA…
Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…
A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…
Q: Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info…
A: Central dogma of molecular biology: It states that the DNA which contains the genes are…
Q: The following triplets constitute anticodons found on a series of tRNAs. Name the amino acid carried…
A: Transfer RNA (ribonucleic acid) is a single-stranded RNA molecule that is used in the translation.…
Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG
A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…
Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…
Q: The following polynucleotide was synthesized and used as a template for peptide synthesis in a…
A: The DNA template is used to form an mRNA polynucleotide by the process of transcription. The mRNA…
Q: Which of the following is the consensus sequence of the Kozak sequence?. O 5'AGGAGGU 3' 0 5 ТАТААТ…
A: Please follow step 2 for detailed explanation.
Q: From this overall anticodon sequence in tRNA,…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…
A: The consecutive three nucleotides together form one codon. Each codon encodes for a particular amino…
Q: Is N-formyl-methionine used to start translation in eukaryotes? Yes No
A: Translation is the process in which ribosomes synthesize proteins after the process of transcription…
Q: According to wobble rules, what codons should be recognized by the follow- ing anticodons? What…
A: Wobble pairing was defined as the base-pairing with two nucleotides that do not follow Watson-Crick…
Q: Provide the DNA sequence (not RNA sequence) for the Start Codon and 3 Stop Codons.
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Q: Give the anti-codon of this Trna?
A: Transfer RNA or tRNA is an adapter molecule, which plays an essential role in decoding the sequence…
Q: Using the genetic code, interpret the following set of nucleotides.…
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Q: What is unusual about the answers for Questions 13k, 13l, 13m, and 13n? Because the multiple codons…
A: Triplets of nucleotides are called codons which specifies individual amino aids in a polypeptide.…
Q: In the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C 5 ’…
A: DNA replication occurs with the help of several enzymes and is always synthesized in 5' to 3'…
Q: The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the…
A: Shine-delgrano sequence in mRNA is essential for the binding of prokaryotic ribosomes to carry out…
Q: Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code…
A: Note - We answer one question at a time. The set of rules through which information in the DNA or…
Q: From this overall anticodon sequence in tRNA,…
A: Anticodon present on the tRNA and it is read in the direction 3'→5' which is complementary to the…
Q: What is the order of the polypeptide chain shown in the images provided? Starting at the…
A: Translation is the process of synthesizing proteins from RNA template through series of reactions on…
Q: 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this…
A: Introduction DNA is a self replicating molecule. DNA synthesis occurs during the S phase of the cell…
Q: N-linked glycoproteins are glycosylated co-translationally at which consensussequence? A) Asn-X-Ser…
A: Protein glycosylation is a complex post-translation modification (PTM) that affects several…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation? *…
A: The process of formation of a polypeptide sequence from an mRNA transcript is known as translation.…
Q: The genetic information contained in DNA consists of a linear sequence of coding units known as…
A: From the given case, it is known that the E. coli DNA has a size of 4.70 X 106 bps. As, it is given…
Q: NA has an anticodon sequence 3′– GGU–5′. Identify the amino acid it is carrying?
A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that takes role in the creation of…
Q: What's the minimum number of tRNAs needed to translate Phenylalanine (Phe) based on the genetic code…
A: tRNA is transfer RNA that acts as a nucleic acid decoder. This plays an important role in the…
Q: The following pattern has been observed in the genetic code. For many codons, the first base…
A: The genetic code is a three-letter code employed by living cells to translate the information into…
Q: THE CODON TABLE FIRST POSITION SECOND POSITION THIRD POSITION TT UU UCU UAU UGU Phenylalanine…
A: Mutations are alterations in the genetic sequence. These alterations can be small or big. The…
Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?…
A: We know that the mRNA carries the codon and the tRNA carries the anticodon. The transfer RNA is the…
Q: Using the genetic code table, find the sequence of amino acids coded by the 2 DNA sequences (documi…
A: Transcription is the process by which the genetic information in the DNA segment is copied into an…
Q: Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the…
A: The sequence are:
Please determine the order of aminoacids from a given genetic code?
5’-UGGUACGGUACUCCAC-3’
Step by step
Solved in 2 steps
- 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd GDraw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphateUsing the following sequence and the amino acid chart, please give the amino acid sequence: 5'-UCAGAUGGGAAGCUUGAUCUUGUGA-3'. Abreviations for the amino acids are accepted. Second Position U A G UGU Cys UUU Phe UUC UCU UCC UCA UCG UAU ]Tyr UAC UGC UGA Stop UGG Trp Ser UUA Levu UUG UAA Stop UAG Stop CUU CỤC CUA CUG CU CC ССА CCG CAU His CAC CGU CGC CGA CGG Leu Pro Arg CAA CAG Gln AUU AUC le AUA AUG Met ACU AAU AAC AAA AAG AGU Ser AGC AGA Arg JAsn ACC The АCА Jlys ACG AGG GCU GGU GGC Gly GUU GAU JAsp GAC GUC Val GUA GCC Ala GCA GAA GGA GGG- GCG- GAG JGlu GUG Third Position (3' end) First Position (5' end)
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13Identify the correct name or abbreviation for the given nucleoside or nucleotide. guanosine ADP dADP dGDP GDP Identify the correct name or abbreviation for the given nucleoside or nucleotide. GDP dADP ADP O deoxyadenosine dGDP OMP O || -O-P-O-P-O. fot O™ tt -O-P-O- O™ ܘ ܐ ܘ ܐ OIPIO N OH OH OH N H₂N N ΝΗ N NH₂8:52 Protein 2-10092015113649.pdf https:api.schoology.comv1attachment169963839... Name Class Date Interpreting Diagrams: Understanding the Main Ideas The Genetic Code (MRNA) Lysine Lysine Asparagine Asparagine Arginine Arginine Serine Serine Isoleucine Methionine Isoleucine Isoleucine Threonine Threonine Threonine U Threonine c Glutamic acid Glycine Glutamic acid Glycine Aspartic acid Giycine Aspartic acid Glycine Valine Valine Valine Valine Alanine Alanine Alanine Alanine "Stop" codon "Stop" codon Leucine Trytophan Cysteine Cysteine Al Gl "Stop" codon Tyrosine Тугosine Serine Serine Phenylalanine Serine Phenylalanine Serine Leucine Glutamine Giutamine CHistidine Histidine Arginine Arginine Arginine Arginine Al Leucine Leucine Leucine Loucine Proline Proline Proline Proline Icl A G Second Base in Code Word Use the information in the accompanying figure to complete the following table. The first row has been completed to help you get started. DNA codon MRNA codon IRNA Anticodon Amino…
- A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptideDetermine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-ArgThe sequence of a 29 aa long peptide can be determined from the following data: Treatment of the peptide with dansyl chloride reveals that the amino-terminal is Val. Trypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: T-1 V-G-A-H-A-G-E-Y-G-A-E-A-T-E T-2 A-A-W-G-KT-3 V-L-S-P-A-K T-4 T-N-V-K
- Which amino acid sequence will be generated? 5'-GAAUGUCUUCGUUAUUGAUGUAGAA-3'Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopGiven the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…