pint intercept used to determine the abundance of a population? umple of the population is counted by sight and then extrapolated into a value for the entire population. the target species and is used to tally the number of individuals near it
Q: Use the following information to answer the next question. Life Cycle of a Pronghorn Antelope…
A: The pronghorn contains deer like body whose tan is reddish brown. *Reproduction is the process of…
Q: Describe the steps of DNA replication.
A: Introduction: DNA replication means replicating or producing two same replicas of DNA from one…
Q: Order: 1 L of 0.9% NS with 40,000 units of heparin over 24 hours. Calculate the rate in mL/h.
A: Heparin is used to prevent or treat certain blood vessel, heart, and lung conditions. Heparin is…
Q: 16. Nitrogen bases pair with bases that are O available identical complimentary O opposite
A: Introduction : The centromere is the region of the chromosome that attaches to a spindle fibre at…
Q: 6) The figure that follows shows DNA fingerprint analysis of the genomic DNA from semen associated…
A: Creating an artificial gene is commonly referred to as DNA printing. There are several methods for…
Q: 1. Consider a cell with surface area 2.5 x 102 mm², initial water potential of -0.3MPa and membrane…
A: When the temperature and the pressure are held constant then the potential energy of the water to…
Q: Cloning vectors are not just limited to bacterial plasmids. Bacteriophages and M13 phage vectors are…
A: Introduction :- A cloning vector is a short bit of foreign DNA that can be injected for cloning…
Q: Pineal body Arbor vitae lateral ventricle cerebellum 3rd ventricle corpus callosum optic chiasma…
A: It is critical to learn and know the anatomy and physiology of the body. Many changes in the animal…
Q: Question 4a-d: H9 IMR90 AT ال ... DMRS Gene Chr10 a. Name one method that could have been used to…
A: DNA methylation is a heritable epigenetic mark that involves DNA methyltransferases covalently…
Q: Where does hematopoiesis take place? spongy bone compact bone osteons outer…
A: Hematopoiesis can be defined as a process through which formation of all types of blood cells takes…
Q: uence below shows a part of the genetic code for the HBB Gene. This gene provides the instructions…
A: Introduction Sickle cell disease (SCD) is a type of blood disorders that are frequently passed down…
Q: A shuttle vector is a vector constructed so that it can propagate in two different host species. One…
A: Shuttle vector It refers to a vector—typically a plasmid—built to replicate in two separate host…
Q: Match each statement with the best possible single answer from the list below. Terms may be used in…
A: Addition of TTGGGG repeats Correct match for this statement are - Telomerase. Explanation…
Q: There are different type of fixatives, classify those fixatives based on its COMPOSITION and ACTION…
A: Fixatives are the physical agents or chemical substances which are used to stabilize or preserve the…
Q: The purpose of the CPHD forum is to provide "...common and effective action to prevent the spread…
A: 1- True CPHD provide common and effective action to prevent the spread and introduction of pests of…
Q: On 17 August 2022, the Ministry of Health of the Democratic Republic of Congo (DRC) reported a…
A: It is well recognized that the Ebola virus (EBOV), a public health emergency of worldwide concern,…
Q: Match the proteins to their functions in DNA replication. DNA polymerase RNA polymerase Helicase…
A: Eukaryotic cells' nuclei and prokaryotic cells' nucleoid regions are where DNA replication takes…
Q: An increase in epinephrine results in: a. An increase activity of insulin. b. An…
A: In emergency or stress condition (Like injury, pain, fear, accident, etc.), impulses from…
Q: If the primers you purchased possessed the following information. 5'-GGA AAC AGC TAT GAC CAT G-3'…
A: Introduction :- All living things require primers, which are brief, single-stranded nucleic acids,…
Q: Suppose you had isolated a new transcription factor and wanted to know which genes this protein…
A: Microarray : is a laboratory technique used to simultaneously measure the expression of thousands of…
Q: Which statement best describes the reason maternal recessive CYP1A1 polymorphisms of CYP1A1 decrease…
A: Answer: ...It increases the metabolism of nicotine. ...It increases the metabolism of PAHs.
Q: a) Which strand is coding strand? b) What is the sequence of the encoded polypeptide? A mutant…
A: The central dogma of molecular biology involves the synthesis of a polypeptide chain of amino acids,…
Q: DNAT A C C G C C C C A T G A T G A A T A C C…
A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…
Q: Twenty hoki (sea fish) are translocated into an aquaculture facility for research. The hoki are…
A: The number of three different genotypes are given: CC 1 CG 7 GG 12
Q: A population of orange trees in a California town experienced a bottleneck. Which of the following…
A: Bottleneck effect severely limit the population size. This results in leaving only a small number of…
Q: Start with a single E/e ; G/g germ cell. It suffers nondisjunction during meiosis II. Which of the…
A: Non-disjunction can takes place in meiosis I or meiosis II where the chromosomes fails to separates…
Q: How do Southern blotting, Northern blotting and Western blotting
A: in genetically modified organism all above three specific separation technique are used for genes…
Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…
A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…
Q: Some organisms thrive at pH 2; other organisms thrive at 65°C. Yet mammals cannot tolerate either…
A: Protein structures are produced by the condensing of amino acids into peptide bonds. The arrangement…
Q: In what type of fluid would you expect to see these cells? What are these cells called?\
A: The cells are the structural and functional unit of living organisms. They perform specific…
Q: (ii) Is the sequence below in FASTA format? Justify your answer. >gi 129295|sp|P01013 | OVAX_CHICK…
A: Sequence alignment is a procedure in bioinformatics where DNA, RNA, and protein sequences are…
Q: Use the following information to answer the next question. The Canada lynx has a diploid number of…
A: Chromosome is an elongated thread like structure which is present inside the nucleus of the cell. It…
Q: Deletion of these two genes resulted in the expression of multiple VSG's simultaneously. a.
A: Trypanosomes Deletion of these two genes resulted in the expression of multiple VSG's…
Q: 14. The table below shows the percentage of Thymine (T) A C search 15% 30% 50% T 20% 60% O G C m…
A: Introduction :- One of the four nucleobases in DNA's nucleic acid, represented by the letters…
Q: Describe the steps of DNA replication. ( keep it short please:) )
A: Why Replicate DNA? The DNA is the genetic material that is the defines in the every cell. Before the…
Q: Which type of ossification process begins with a hyaline cartilage model that has two ossification…
A: Introduction : The bones and cartilage in the baby skeleton are relatively larger in number. Many…
Q: You have two DNA samples. Only one was expected to have plasmid DNA that was isolated from it. Both…
A: Since only one out of two samples has plasmid DNA. The sample with DNA of other forms can be…
Q: 2. If a potted plant is covered with a glass jar, water vapors appear on the wall of glass jar.…
A: Transpiration is the process through which water is evaporated from plant components with stomata,…
Q: When two molecules of glucose go through glycolysis, how many molecules of pyruvate are formed? a.…
A: Please follow step 2 for detailed explanation.
Q: 7.13 In rabbits, the dominant allele C is required for colored fur; the recessive allele c makes the…
A: Introduction :- The relationship between two genetic variants is referred to as dominant. Each gene…
Q: Clary Leonhart used the pET vector system to express her prokaryotic amylase enzyme. added peptone…
A: i) Clary failed to obtain her protein of interest in this experiment because she forgot to induce…
Q: the Match the appropriate component of the electrocardiogram with the number on the ECG aka EKG. T S…
A: Electrocardiogram or ECG aka EKG is a tool for evaluating the electrical events during cardiac…
Q: A shuttle vector is a vector constructed so that it can propagate in two different host speci One of…
A: Shuttle vectors are mostly plasmid vectors that are compatible with two host cells thereby allowing…
Q: Autodock, Gold and Glide are other bioinformatics tools that are widely utilized by many researchers…
A: A technique called molecular docking examines how molecules are oriented and conformed within a…
Q: Explain mechanisms of action in endocrine signaling, taking Adrenalin-induced fight or flight…
A: A complicated system of glands and organs makes up the endocrine system. Body's metabolism, energy…
Q: The haploid number of chromosomes in a cell of a grasshopper is 18. How many chromosomes are in a…
A: A chromosome is a lengthy DNA molecule that contains all or a portion of an organism's genetic code.…
Q: Out an outbreak investigation for communicable diseases is key in disease prevention. Examine the…
A: A communicable disease is one that transmits from one person or animal to another. These diseases…
Q: What are lipids and how can lipids be identified based on their physical propeties? How are lipids…
A: Lipids are molecules that contain hydrocarbons and make up the building blocks of the structure and…
Q: A B Figure 1 The postgraduate student, Vanessa, cloned her gene of interest into two different…
A: A vector is a living organism that can transmits an infectious agent from an infected animal to…
Q: To investigate the properties of cell membranes, a scientist used the Fluorescence Recovery After…
A: Specific light wavelengths stimulate fluorescent markers, which then emit light with a different…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- A Ims.moe.gov.ae/Dashboard#!/view/328891//1027748/Activities I Managed bookmarks Chargaff's Rule Review äiglho äliwill JS - älimi 2 Below shows the amount of base percentages for given organisms. Using Chargaffs Rule, enter in the missing base percentages for 2 each organism. Please ensure to enter in all answers as a percentage (i.e. 17% not 17) Organism Adenine Cytosine Human 23% Monkey 15% Camel Dog Dolphin 33% والسابق plm alimi 2/ ailc äibul ani Jigu 0 Intro to C 8:23 11/11,C5 x P Parchment Exchange - Leader earn.edgenuity.com/player/ ence- SC5181 A G 5 Mark this and return G how would scientists describe th Why is random distribution of species the least common pattern? O It eliminates the protection benefits provided by a large group. O It decreases competition among members of the population. O It reduces the amount of light that producers can get from the sun. OIt does not mirror how resources are distributed in nature. X O Σ how is point intercept used to de x + Save and Exit Next 0 < English Sign out v ☆ E. 0 Kinley He Submit Oct 27 2:08A testing.luminateed.com |白G O Question 26 | 2020 Ecology 2: Populations | Iluminate Online Testing Q 6.3 Biology Flashcards | Quizlet 2020 Ecology 2: Populations Signed in as: Asiya Dockery Question 26 II Pause Q Zoom Q Review / v Finish Test ABC Question 26 Which of the following organisms are NOT considered an "R-strategist"? O A Roaches B Spiders Frogs D Giraffes ©2020 Illuminate EducationTM, Inc. %23 2$ 3 4. 6. 8. Q W T Y tab H. K S D caps lock C V N alt olt command option control option command V N
- QUESTION 7 You are working on an undergraduate project, studying an insect species. A recent study showed that the pigmentation pattern used for camouflage is made by an enzyme K. However, it has been shown that, when compared to the Kk individuals, the KK homozygotes would have a higher chance of dying from pigment overdose before growing up, while the kk individuals can easily fall to predation before becoming adults. In fact, when compared to the Kk individuals, the estimated selection coefficients for KK and kk are 0.25 and 0.5, respectively. You are interested in what would happen to these alleles. At present, you have conducted a population survey and have 1000 larvae in your collection. Among them, 360 are KK, 480 Kk and 160 kk. How many larvae would survive to adulthood? O 170 O 417 583 750 830 (Following up on Question 7.) What would be the KK genotype frequency at the adult stage? O 0.090 O 0.270 O 0.325 O 0.360 O 0.529 QUESTION 8- SC5 X P Parchment Exchange - Leader in X G how would scientists describe th x e.learn.edgenuity.com/player/ Science - SC5181 A 1 2 5 How would scientists describe the density of a population? O 47 giraffes living on the African savanna O 194 nematode worms in a given area of soil O 1,500 frogs living in a large pond O6,000 starlings flying in a flock going south Mark this and return how is poir- SC5 X ET AET Login 9.core.learn.edgenuity.com/player/ cience - SC5181 A ent X + 1 2 3 4 5 v6.1.1-0050.20220124.mainline Ⓒ2022 Imagine Learning LLC Sudden change will affect the new population more severely due to the genetic bottleneck from a small population. The new population will be less genetically diverse than the original one since there are fewer alleles available. The populations would experience the same effects because all the bison that had been reproducing before the 12 bison left. Natural selection will affect the new population differently than it affects the original population. The new population will have less genetic drift than the original population because there are fewer genes. O O Question # 2 Multiple Select Suppose a population of 150 bison is wandering and grazing in an area where there is an old bridge across a river leading to a new field. After 12 bison make it across, the bridge collapses. Assuming equal numbers of males and females, what will most…
- While studying a emerging population of seals, you're asked to determine if the population is in Hardy-Weinberg equilibrium. Given the below data determine the chi square and whether the population is in H-W equilibrium. Choose the closest numerical answer for the chi-square value and either yes or no regarding whether the population is in HWE. AA - 45 Aa - 35 aa - 20 A chi-square critical values table is here (Links to an external site.). Group of answer choices 2.56 6.42 6.20 6.92 No Yes 3.45inate S_Q1_Science_Biology_2022-2023 Question 1 200 TIDO D D BO 70 60 550 40 30 20 10 OF 0 5 X me graph shows the growth of the P caudatum population when it is grown separately. P. caudatum Alone 250 200 150 5 V 10 Time (days) Q Zoom 10 Time (days) 15 15 The graph shows the growth of the P. aurelia and P. caudatum populations when they are grown together. Both Species Grown Together 20 2022 Illuminate Education TM, Inc. Question 1 Which statement is supported by the graphs? A A B C D Accessibility Tools Signed in as: Zavion Ma Q Review/✔ Finish T ABG P. caudatumrand P. aurelia competed equally for resources. P. aurelia and P. caudatum did not compete for resources. P. aurelia was better able to compete for resources than P. caudatum P. caudatum was better able to compete for resources than P. aurelia Z3. To compare your observed results with those expected, you can use the statistical test, chi-square. Table 3 will assist in the calculation of the chi-square test. Note: To calculate chi-square you must use the actual num- ber of individuals for each genotype, not the frequencies. S d² d²le Observed value (0) Expected value (e) Deviation (o-e) = d Table 3 Chi-Square of Results from the Bead Model Chi-square (x²) = Edle 6 182 AA (1 18 -7 4.9 2.7 greater p=0.25 Aa 30 24 le зи 697 1.5 4.3 Degrees of freedom = 2 Level of significance, p < 0.05 estmanst 17 aa 4. Is your calculated x value greater or smaller than the given x² value for the degrees of freedom and p value for this problem? 6 /98.0 9 8 1 0,1
- A population of boreal toads has a current size of 100 and time steps are measured in years. If the instantaneous rate of increase is 0.8 (toads/(toadXtime)), what will the expected population size be after two years? Note: You need to first figure out which equation to use for this problem. O 64 toads O 117 toads O 495 toads O 6400 toads No toads will be left because the instantaneous rate of increase is less than 1.0.A population of wolves in a national park is known to be 150 individuals. As wildlife ecologist, you are tasked with assessing the accuracy of the mark and recapture technique. At the start, you mark 30 wolves, and your recapture yields 20 wolves, 5 of whom are marked. State whether the mark and recapture data results in an over or underestimation of the actual population size, and show work to support your claim.Quadrat sampling is a method by which organisms in a certain proportion (sample) of the habitat are counted directly. As with all sampling methods, it is used to estimate population parameters when the organisms present are too numerous to count in total. It can be used to estimate population abundance (number), density, frequency of occurrence, and distribution. Quadrats may be used without a transect when studying a relatively uniform habitat. In this case, the quadrat positions are chosen randomly using a random number table. The general procedure is to count all the individuals (or estimate their percentage cover) in a number of quadrats of known size and to use this information to work out the abundance or percentage cover value for the whole area. The number of quadrats used and their size should be appropriate to the type of organism involved (e.g. grass vs tree). Estimated average density Total number of individuals counted Number of quadrats X area of each quadrat Guidelines…