Q: Explain how the disruptions in the electron transport chain leads to the production of reactive…
A: The electron transport chain is a series of protein complexes and electron carriers that are located…
Q: _______ is the net movement of substances from a high concentration to a low concentration medium,…
A: Introduction: Diffusion is the overall net movement of anything from a higher concentration to a…
Q: 5. The human ABO blood groups are A, B, AB and O. They are determined by a single gene with multiple…
A: Given that four babies with blood groups O, A, B and AB have been mixed up in maternity ward. Ghe…
Q: What are the major benefits and the disadvantages of a rumen system? How does a cecal animal compare…
A: Rumen system is the ruminant digestive system. Ruminants are those who eat plants- herbivorous…
Q: how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical…
A: Nucleotides are organic molecules made up of a phosphate and a nucleoside. They function as…
Q: Explain this statement: should be atleast 2 paragaphs or more (grade 11 biology) Groups of organs…
A: An organ system is a group of organs that work together to perform a specific function or set of…
Q: Part 1: Briefly describe the levels of organisation within the Human body. You should start your…
A: Organizational levels are natural structures that are typically described by part-to-whole…
Q: What type of bond occurs when electrons are shared between atoms? hydrogen bonds covalent bonds…
A: There are different types of biological interactions occur in the molecules.The bonds present in the…
Q: Explain the steps for the reproduction of slime mold according to the image !
A: A variety of distinct eukaryotic organisms having a life cycle which comprises a free-living…
Q: What is the difference between coagulatiive and liquefactive necrosis? How are they related to…
A: Necrosis is referred to unprogrammed cell death due to a disease or an injury. It can affect many…
Q: Which of the following general transcription factors are indicated as "minimally required" for…
A: Transcription factors are proteins that "bind to promote areas and aid in the initiation of…
Q: Describe the path and all related steps that a molecule of oxygen would take from the air in the…
A: First of all we know that respiration is a very essential process for our body.Only throgh this…
Q: What happens when large natural and/or man-made deforestation occur? How does the plant control the…
A: The epidermis of plant cells has specialized openings called stomata. They are crucial to the carbon…
Q: 7. Which stage of cell division contains the most amount of DNA? Telophase Prophase Cytokinesis None…
A: The cell cycle is the sequence of events that a cell goes through as it grows and divides. The cell…
Q: What are the two types of Vascular Tissue? Briefly explain each type of Vascular Tissue.
A: Tissues are the group of cells that perform a specific function. These cells have structural and…
Q: How do you sequence a genome and what are the steps involved?
A: ANSWER) DNA sequencing is described as the laboratory process in which the DNA sample is extracted…
Q: The identity of Kim's biological father is unknown, but it is thought to be either Kevin or Thomas.…
A: DNA fingerprinting is a method of identifying an individual based on their unique DNA pattern. It…
Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…
A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…
Q: Select one specific compound representing a larger metabolite group (e.g. menthol for terpenes),…
A: There are several primary and secondary metabolite secreted from the plant as defense compounds. One…
Q: Explains in a paragraph of 700 words the evolution of the beluga in Canada, until now its…
A: The Hudson Bay, the St. Lawrence Estuary, and Canada's Northern area are home to the beluga, also…
Q: 1. On your ovulation chart, mark the unfertile, likely to be fertile, and the most fertile days. Put…
A: Menstrual liquid comprises blood, endometrial cells (uterine lining cells), and mucus. Menstruation…
Q: What is the purpose of an emulsifying agent? List atleast 5 examples used in pharmaceutical…
A: Emulsifying agent An emulsifying agent also called emulsifier refers to a surface-active ingredient…
Q: 2. Fill in the labels on the following diagram that shows the light reactions of photosynthesis.
A: There are a few important points : We know that photosynthesis will take place in the green parts…
Q: 2. Large predatory marine fish (ex: tuna, swordfish, marlin, shark, etc.) usually eat at the third…
A: Large predatory marine fish, such as tuna, swordfish, marlin, and shark, are often considered…
Q: In this diagram, which of the following is TRUE? H+ (proton) Organic molecule that includes two…
A: Option B ) The NAD+ becomes reduced.
Q: Part IV-Conclusion Suzanne and David did undergo two cycles of PGD. In the first cycle, the two…
A: In-Vitro Fertilization is an artifical procedure through which babies can be produced.This is mainly…
Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…
A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…
Q: What is the optimal pH range for (PACI) coagulant?
A: A coagulant is a chemical that is generally used in water treatment to remove suspended solids in…
Q: ations by assigning the prop
A: Histidine is a major amino acid that plays a crucial role in protein biosynthesis. Histidine amino…
Q: An experiment was conducted looking at the likelihood to get covid when you are not vaccinated,…
A: The independent variable is the variable that is changed or manipulated by the researcher.
Q: Answer this question, well detailed with a lot of information filled in. It is important to answer…
A: Beluga are type of whales whose population is declining rapidly. They mainly live in Arctic Ocean in…
Q: Lipids most abundant form are Triglycerides building blocks are 1 If a triglyceride only contains…
A: Introduction:- Lipids and Proteins are categorised under bio-macromolecules. Proteins are higher…
Q: why doesnt this chi square value fit the number of expected with independent assortment?
A: Genetics can help us understand the evolution of species: By studying the genetics of different…
Q: 1. Why do autumn leaves turn yellow and fall?
A: Introduction:- Plants are photosynthetic eukaryotic organisms that can make their food by themselves…
Q: Which of the following is true about MHC? Check all that apply. A. MHC I is expressed in all…
A: Major Histocompatibility Complex(MHC) is basically a group of genes on DNA.It mainly helps the…
Q: Which type(s) of reservoirs are the hardest to control & make some diseases impossible to eradicate?…
A: B. Humans and c. Environment
Q: The IMD2 promoter contains three upstream transcription start sites (TSS) that are utilized under…
A: Inosine monophosphate dehydrogenase (IMD2) is a key enzyme in the purine biosynthesis pathway that…
Q: What does Homeostasis mean and can i have some examples?
A: Introduction: Any self-regulating process called homeostasis helps biological systems to maintain…
Q: You have consumed a six-pack of beer in the course of an evening. The intake of alcohol can decrease…
A: Hormones are chemical signals that are directly secreted into the blood, where they are transported…
Q: Discuss the various definition of morphology. 2.What is your own definition of morphology?
A: We can classify and identify different organisms in different aspects.We can classify them using…
Q: Do you find the arguments for the continuance of eating meat by humans compelling? What are the…
A: There is no question that meat has played a fundamental role in the evolution of humans. Our…
Q: Use one of the seven principles of biomechanics to explain. How were you stronger? Knee down and…
A: The skeletal system helps sustain posture and balance and safeguards the interior organs.…
Q: Medium/test Gram stain TSA Eosin methylene blue agar (EMB) SIM motility agar Brewer's plate in…
A: In microbiology, different tests are used to test the presence of various microorganisms. The…
Q: which of these is a/arepossible treatment option(s) for the disease(s) caused by mutations within…
A: A. Surgery - Surgery is a procedure that involves cutting of a patient's tissues or closure of a…
Q: Oil-based paints contain organic solvents, which may be toxic. What are the two main entry routes…
A: ANSWER) Oil based paints contains hydrocarbons which are the poisonous components of the these…
Q: 11. What is the result of light energy absorbed by photosystem I? a. b. C. d. It energizes an…
A: In a non-cyclic photophosphorylation Photosystem I (PS700) absorbs light energy. It results in the…
Q: Unambiguous Nonoverlapping ○ Universal 4. The promoter region contains a consensus sequence where…
A: The promoter region is a specific DNA sequence located upstream of a gene that is responsible for…
Q: With an example, explain how a change in an amino acid can change the structure of a protein.
A: The amino acid sequence of the protein is responsible for generating its 3D structure. A mutation in…
Q: 1. Discuss the excretion and retention of proteins by the glomerulus.
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 5. Looking at the polymer, why is a DNA considered antiparallel? 6. Why are the ends of DNA strands…
A: DNA is made up of nucleotides, the monomeric building blocks of the DNA. Each DNA polymer consists…
Name at least two diseases that have been eradicated due to immunization.
Step by step
Solved in 4 steps
- Why is transmission of cytomegalovirus (CMV) through blood components not a significant risk to most recipients? Question 10 options: a) Most recipients are CMV-positive. b) Most recipients are CMV-negative. c) The CMV cannot tolerate cold storage temperatures. d) None of the above.What physical and chemical methods could break the chain of infection?Which of the following is NOT a primary immunodeficiency? O 1) SCID O 2) Agammaglobulinemia O 3) DiGeorge Syndrome O 4) AIDS
- Part A) What barrier was breached by the pathogen? Part B) Describe how that barrier works and how it can prevent mom's pathogens from infecting the fetus. A tiny 1-kg (2.2-pound) female neonate (newborn) was born two months premature. The baby had extreme difficulty breathing and had to be intubated (a breathing tube inserted). The mother, at the time of admission, had complained of mild diarrhea and abnormal abdominal pain unrelated to her pregnancy. The infectious disease doctor who was called in to consult on the case immediately recognized the likely problem and ordered blood cultures be performed on the infant. The infant was also started on intravenous antibiotics. Two days later, the lab reported finding a Gram-positive bacillus-Listeria monocytogenes-in the infant's blood. This same organism was the cause of the mother's diarrhea. The mother had unwittingly ingested some unpasteurized cheese contaminated with this pathogen and developed listeriosis. The organism entered the…Draw an editorial cartoon on the importance of the roles of the multi-agency teams in communicable disease prevention and control. Explain the meaning of the cartoon.What political and societal factors might lead to a decrease in childhood immunizations?
- Why is it helpful for scientists to use models to simulate the spread of a communicable disease?Respond to the following questions and provide a rationale for your answer A) can infectious diseases be non-communicable? In your own word justify your answer B) can communicable diseases be non-infectious? In your own word justify your answer C) why are primary prevention measures more complex for chronic diseases such as heart disease or cancer than for infectious acute conditions like cholera or Lyme disease?Below are a list of virulence factors/ strategies paired with an example of an organism that utilizes them. How do each of the following strategies contribute to the virulence of the pathogen? Strategy - Causes the host to produce more receptors (Organism - Rhinovirus) Strategy - Produces gas as a product of fermentation (Organism - Clostridium perfringens) Strategy - Produces a capsule (organism - Klebsiella pneumonia) Strategy - Ability to move between adjacent cells (organism - Cytomegalovirus) Strategy - Ability to use pilus as a motility structure (organism - Pseudomonas aerogenosa)
- Infections in the blood and circulatory system tend to be more dangerous because they are not localized to one specific area. a) True b) FalseIn the early 1900s, cities such as Philadelphia reduced the incidence of typhoid fever by: Question 1 options: A) isolating human carriers. B) using tertiary water treatment systems. C) filtering municipal drinking water through sand-bed filters. D) requiring residents to boil drinking water.Which of the following describes a primary prevention approach? A) Vaccination of children, adults and the elderly B) Nutritional and food supplementation C) Dental hygiene education and oral health services D) All of the above