MOLECULAR CLONING • Molecular cloning is the laboratory process used to create recombinant DNA. • It is one of two most widely used methods, along with polymerase chain reaction (PCR). • Molecular cloning involves replication of the DNA within a living cell, while PCR replicates DNA in the test tube, free of living cells. • Formation of recombinant DNA requires a cloning vector, a DNA molecule that replicates within a living cell.

MOLECULAR CLONING • Molecular cloning is the laboratory process used to create recombinant DNA. • It is one of two most widely used methods, along with polymerase chain reaction (PCR). • Molecular cloning involves replication of the DNA within a living cell, while PCR replicates DNA in the test tube, free of living cells. • Formation of recombinant DNA requires a cloning vector, a DNA molecule that replicates within a living cell.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 6QP: Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel,...

See similar textbooks

Similar questions

In extracting and Isolating a DNA from yeast and fruit. • What is the role of salt and dishwashing liquid in the extraction/isolation of DNA from yeast and fruit ? EXPLAIN !!
Home Work: • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5' -СТАССТСCGGGTTGACTGСТАССТТССССGGATGCCCAAAAТТСТСGAG-3— :::::::::::: :::::::::::: :::: +3'-GATGGACССССААСТGACGATGGAAGGGCCCТАССGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is happening at each step. (1) température cycle #1
DNA fragments cut by restriction enzymes can form two types of ends. What are these ends called? • View Available Hint(s) salvage and sharp ends tails and heads sticky and blunt ends ligase and blunt ends
Protein Synthesis and Mutation Practice • Complete the lines below by determining the mRNA transcript and amino acid sequence. • Compare the mutant DNA strands to the wild type strand. ⚫ Circle the mutation in the mutant DNA strands and describe the type of mutation (frameshift - insertion, frameshift - deletion, point - missense, point - silent, or point-nonsense). Not all of these will be used in this assignment! Wild type DNA template: 3' TACGCGTGCACGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Mutation #1 DNA template: 3' TACGCGTGCACGATCCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #2 DNA template: 3' TACGCGTGCTCGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:
Compare the possible differences between a eukaryotic protein-encoding gene cloned by PCR and the same gene cloned by reverse transcriptase PCR (RTPCR).
Which technique rapidly replicated specific DNA fragments without cloning in cells? (a) gel electrophoresis (b) cDNA libraries (c) DNA probe (d) restriction fragment length polymorphism (e) polymerase chain reaction
Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.
Recombinant DNA Technology Provide a detailed explanation how DNA structure is exploited for the following techniques DNA Sequencing Molecular Cloning Polymerase Chain Reaction (PCR)
The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). at of Koni Sall Eo R Pat Bam H Xhot Bem H Pat E Kon 100 200 300 400 s00 s00 700 00 00 1000 1100 1200 1300 1400 1600 1800 1700 1800 100 2000 The gel below shows: • a DNA ladder with markers every 200 bp (DNA Ladder) the resulting restriction fragments of the above DNA fragment if it was completely digested with the restriction endonuclease Xho I (Xho I Digest) the resulting restriction fragments of the above DNA fragment completely digested with unidentified restriction endonuclease(s) (lanes A through F) Which lane shows the DNA fragment completely digested with Pst ? Xho Digest Lanes DNA Ladder A. D F 2000 bp 1800 bp 1600 bp 1400 bp 1200 bp 1000 bp 800 bp 600 bp 400 bp 200 bp ||
%3D 12/15 Which question MOST likely may have led to the development of recombinant DNA technology? Can human genes be integrated into bacterial DNA so Can Can DNA be cut into fragments by restriction enzymes Can human genes be introduced into the undifferentiated cells be used to and then separate into unique patterns? bacteria can copy the genes and produce their proteins? repair parts of the body? cells of people with genetic disorders using a virus? Music off Zoom In Sign out O 3:26 Lenovo
1) Follow the steps involved in DNA or gene cloning 2) In what process do bacteria take up the recombinant plasmid DNA 3) What are the advantages or replications of gene cloning?
What is happening in each steps in standard method of molecular cloning. 1: choosing vector and clone host. 2: Preparing vector DNA 3: Preparing DNA to be cloned 4: creating a rDNA (recombinant DNA) 5: Introducing rDNA into the selected host. 6: selecting organisms that contain rDNA. 7: screening for the clones with desired biological properties and DNA inserts.