Q: How are Recombinant DNA formed? What is the difference between genetic modification and selective…
A: DNA recombination is a technique by which hybrid DNA is constructed by inserting desired DNA…
Q: How does size of DNA affect size traveled during electrophoresis?
A: Electrophoresis is a technique for the separation followed by the analysis of the macromolecules…
Q: What is the meaning of DNA clone?
A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that coil around…
Q: What happens if DNA polymerase fails to correct an error?
A: DNA is a nucleic acid that serves to store genetic information.
Q: Do most cells contain complete copies of an organism’s DNA? Do most cells express all of the genes…
A: Genome is composed of all the genes present in an organism present in the nucleus. A genome can be…
Q: Once DNA is extracted, what can it be used for?
A: Genetic material is the molecules which should have certain characteristics like it should replicate…
Q: How does a DNA microarray work?
A: Gene microarray technology enables to deposit many different DNA sequences on a small glass slide,…
Q: What is the purpose of genetic transformation?
A: Genetic transformation is a genetic alteration process that involves incorporation and expression of…
Q: How to identify recombinant DNA?
A: When a desired foreign gene or a particular segment of foreign DNA is inserted into the host genome,…
Q: In making recombinant DNA, what is the benefit of using a restriction enzyme that cuts DNA in a…
A: Introduction Enzymes play a key role in biotechnological tools which helps in various invitro…
Q: In the extraction of DNA of Banana, what do the DNA look like?
A: Introduction Bananas are elongated, edible berries produced by several species of big herbaceous…
Q: What are techniques available for Analyzing DNA ?
A: Techniques which are availaible for Analyzing DNA are : By the use of Methylation and Sensitive…
Q: How to analyze recombinant DNA molecules ?
A: Bacterial transformation is a recombinant DNA technology, used for introducing a gene of interest…
Q: What is involved in DNA sequencing?
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: What is an advantage of using recombinant DNA to make proteins such as insulin, human growth…
A: Recombinant DNA molecules are DNA molecules formed by laboratory methods of genetic recombination…
Q: What are genomic DNA libraries ?
A: Contains DNA fragments representing entire genome of an organism. Created using molecular cloning.…
Q: What is the role of alcohol in extracting DNA?
A: DNA (Deoxy Ribonucelic Acid) extraction is carried out to perform experiments. The first…
Q: What is the purpose of recombinant DNA?
A: Purpose mentioned below.
Q: What is the principle of DNA isolation?
A: DNA isolation is a process through which the intact DNA of the organisms is extracted and used for…
Q: Distinguish between digesting DNA with restriction enzymes and mechanical shearing of DNA?
A: Known specific sites are digested by the help of the restriction enzyme for the digestion of the…
Q: How could DNA-mediated transformation be used to test chemicals for their mutagenic activity?
A: Deoxyribonucleic acid (DNA) is an inheritable entity of almost every living organism. It is…
Q: Is it biologically advantageous that DNA is stable?
A: DNA (deoxyribonucleic acid) is a double helical twisted ladder-like structure that stores and…
Q: What is recombinant DNA? How can it be used to produce human proteins in bacteria?
A: Recombinant DNA: Recombinant DNA is produced by combining DNA segments that doesn't normally occur…
Q: How is the recombinant DNA cloned or amplified?
A: DNA fragments that contain the sequences of interest can be produced by digestion using restriction…
Q: Can DNA be isolated from beef? Discuss the process briefly
A: The purification of DNA from the collected sample of DNA with the help of the various methods and…
Q: What is Recombinant DNA?
A: Question is about recombinant DNA .
Q: Why is DNA denaturation important?
A: DNA denaturation aka melting is the separation of the double strands of the DNA into 2 individual…
Q: What are the advantages of doing DNA sequencing?
A:
Q: How does salt help in the DNA extraction process?
A: DNA is extracted to compare the DNAs from different sources and to study the sequence differences.…
Q: What is transgenic DNA?
A: Recombinant DNA technology involves integrating DNA molecules from two different species and…
Q: How is DNA amplified in a polymerase chain reaction(PCR) procedure?
A: Step 1 Polymerase chain reaction (PCR) sometimes also called molecular photocopying is a technique…
Q: In this picture of gel electrophoresis of DNA, which sample contains the longest/largest piece of…
A: DNA (Deoxyribonucleic acid) is a double helical structure that consists of nucleotide. Nucleotide…
Q: How is a recombinant DNA molecule generated?
A: Recombinant DNA is known to contain DNA segments from multiple sources and is constructed via…
Q: After a piece of DNA is sequenced, what type of analyses can be performed?
A: After the sequence of the DNA have been found many analysis are performed on the DNA.
Q: How will you obtain purified DNA from a cell?
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: How can specific genes be retrieved from a DNA library?
A: Deoxyribonucleic acid or DNA is a molecule that contains the genetic code of the organisms. DNA…
Q: How is genomic DNA prepared for shotgun sequencing?
A: Genomic DNA prepared for shotgun sequencing as follows : 1. ligating random genomic DNA fragments…
Q: What does PCR allow you to do with DNA?
A: NOTE:- "As you have asked multiple questions under one, we will solve the first part for you, to get…
Q: Do DNA-polymerase enzymes also function as exonucleases?
A: DNA polymerase enzyme is primarily responsible for the synthesis of DNA by the attachment of various…
Q: What is/are the purpose of DNA extraction?
A: DNA is the genetic material present in almost all living cells. The DNA is responsible for various…
Q: What are recombinant DNA molecules?
A: A technique that alters the phenotype of an organism when its genome is integrated with the…
Q: Describe how certain restriction enzymes generate DNA fragments with sticky ends, and others…
A: Restriction enzymes also called molecular scissors are the type of nuclease enzymes that cleaves the…
Q: Restriction enzymes look for palindromic sequences of DNA to cut, how does it recognize those…
A: A restriction enzyme or restriction endonuclease is an enzyme that cleaves/cuts DNA into fragments…
Q: If the GAATTC palindrome is repeated four times on the same piece of linear DNA, and the restriction…
A: The restriction enzymes are responsible for cutting the double stranded DNA molecules at specific…
Q: Do restriction enzymes always cut the DNA at the recognition sequence?
A: Restriction enzymes are a class of enzymes that cut DNA into fragments based upon recognizing a…
Q: What is DNA cloning?
A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that coil around…
Q: How would one recognize a gap in the genome sequence following nucleotide sequencing?
A: DNA is made up of four bases namely adenine (A), thymine (T), cytosine (C), and guanine (G). The…
Q: Why don’t bacteria cut up their own DNA when they produce restriction enzymes?
A: Restriction enzymes are the proteins which can cut double stranded DNA segments only at some…
Step by step
Solved in 4 steps
- nce.com/student/studentformative/ Online Tools Question 6 (2017 6C) A model of a biological process is shown. MRNA 3' AGCUGACC G GACA A GAU CG C Asp Ala Leu teu What is the purpose of this process? Answer To replicate the DNA of an organism before cell division G To assemble nucleotides in an mRNA chain along DNA template H To synthesize amino acids used to unzip strands of DNA and copy the genetic code To translate the genetio code into a specific sequence of amino acids chnologies InTC 2021 - Edugence MBOn further analysis of the DNA described in conceptual questionC21, you discover that the triplex DNA in this alien organism iscomposed of a double helix with a third strand wound within themajor groove (just like the DNA in Figure shown). How would youpropose that this DNA is able to replicate itself? In your answer,be specific about the base-pairing rules within the double helixand which part of the triplex DNA would be replicated first.ent id%3_12087988 18step%3Dnull QUESTION 1 If the base sequence of one DNA strand is AATGCAT, what would the complimentary sequence be? 1 points Save Answer O TATCCAC O AATCGAT O TTACGTA O UUAGCAU QUESTION 2 1 points Save Answer Translation occur in the nucleus. O True False
- DNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?ce.com/student/studentformative/ Online Tools Question 7 (2015 6C) Part of an important cellular process involving a DNA strand is modeled below. 3'- 5' What is the purpose of this cellular process? Answer Preserving genetic information for future generations Deleting the information in the sequence produced from the DNA template Transcribing information in the DNA sequence for use by the cell D Producing more nucleotides for the DNA sequence Question 7 Previous Edunance MBPart 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…
- 7:07 1 How Mutations Occur (Developing) Question O Practice It! /// A Select the statement(s) that accurately describe the function of DNA polymerase and the types of mutations that may occur. O Point mutations occur when a single nitrogenous base is substituted. Frameshift mutations occur when a nitrogenous base is inserted or deleted. start d le O Point mutations are less serious than frameshift mutations, as only a single base pair is affected. DNA has rare mutations during replication because DNA polymerase functions to build and repair errors in nitrogen base pairings of A-G and T-C. 3 Pro O DNA has rare mutations during replication because DNA polymerase functions to build and repair errors in nitrogen base pairings of A-T and G-C. O Point mutations occur when a nitrogenous base is inserted or deleted. Frameshift mutations occur when a single nitrogenous based is substituted. B.McKenzie - Uncontrolled Cell Growth B.McKenzie - Uncontrolled Cell Growth B.McKenzie - Uncontrolled…Natte को irvicle ie wnd te the following DNA Olympics eralls a od come odents, at wy h wy ed ip the ar (warm up) y and anawers e Period a Name Caitlin Myers be writtenin usion sentena DIRECTIONS: Complete each of the following "events" in their proper order. In the first event, you must transcribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN'. When your protein is completed, the final event is to match your protein with its proper trait (ex: tongue rolling). our. thin 1. ATGCATGCGCGACTGG G G TC GGAGTGG 5TACaTACacaCTQACC CCAQCETCACC 31 MRAA -7 AUG CA aca ca4 Eug pca atq yeg sletion Yeu. eiy Ser. HiS. Protein AGI TTC 2. ATGGTACAGAA A A -ACCAT AAGITIIS MRNA- 3. ATGTGTCCAGGTACGTCGTAAGAGATC rotcin is actually a very long molecule composed of many hundreds or thousa Idod on itself many times to create a…22.124 Give two reasons why bacterial cells am wred for recombinant DNA procedures. Nucleic Acids 1015 22.125 What role do plasmids play in recombinant Polymerase Chain Reaction (Section 22.15) 22.131 What is the function of the polymerase chain DNA procedures? 22.126 Describe what occurs when a particular restric- reaction? tion enzyme operates on a segment of double- stranded DNA. 22.127 Describe what happens during transformation. 22.128 How are plasmids obtained from E, coli bacte- 22.132 What is the function of the enzyme DNA polymerase in the PCR process? 22.133 What is a primer and what is its function in the PCR process? 22.134 What are the four types of substances needed to carry out the PCR process? ria? 22.129 A particular restriction enzyme will cleave DNA Sequencing (Section 22.16) DNA between A and A in the sequence AAGCTT in the 5'-to-3' direction. Draw a dia- gram showing the structural details of the "sticky ends" that result from cleavage of the following DNA segment.…
- During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicaseYou do a PCR reaction,run a sample of the product on a gel,and use a dye to visualize the bands. Youexpect a single product of 300 bp, whichyou observe, but you also see a band ofabout 550 bp. Can you suggest a reasonwhy? Does the size of the unexpectedband indicate anything about your targetsequence?A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' What is the base sequence of the synthesized fragment? O 5'-AGTCGAAT-3' ddCTP O 5'-TAAGCTGA-3' I ddGTP