Match the E. coli mismatch repair enzyme on the left with the appropriate function on the right. MutS MutH MutL a. facilitates the looping of the region of DNA to be replaced b. distinguish between parental and newly-synthesized DNA c. locates mismatches in the DNA

Match the E. coli mismatch repair enzyme on the left with the appropriate function on the right. MutS MutH MutL a. facilitates the looping of the region of DNA to be replaced b. distinguish between parental and newly-synthesized DNA c. locates mismatches in the DNA

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 5RQ: The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA...

See similar textbooks

Related questions

Q: linkage disequilibrium

A: a) Linkage: Linkage is the phenomenon of certain genes staying together during inheritance…

Q: A) If one of the primers has a point mutation distinct from the template what is the percentage of…

A: PCR or polymerase chain reaction is a technique which is used in amplification of DNA or produce…

Q: A. A plasmid is shown with the locations of various restriction enzyme sites labeled. If you cut the…

A: if we cut the plasmid with XhoI and XbaI then we will get three fragments of following sizes 1000…

Q: Using nucleotide letters, show the kind of cut that could be made on a DNA molecule to circularize…

A: A plasmid is a small, extrachromosomal DNA molecule within a cell that is different from the…

Q: The following diagram shows one-half of a restriction site. (a) Draw the other half. GAC G I C (b)…

A: Introduction: The genetic material in the living organism that transfer from one generation to…

Q: Describe What are the sticky ends of the restriction fragments? Select one: a. The surfaces of…

A: Restriction endonuclease are enzymes that help divide DNA and generate small pieces in molecular…

Q: A linear plasmid contains only two genes, which are transcribed in opposite directions, each one…

A: There are two forms of plasmid known. One is circular and another is linear. The circular plasmid is…

Q: I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: a) What dipeptide is produced from the following segment of DNA: AGAGAT? (b) What happens to the…

A: Gene expression is the process in which information stored in the DNA is converted into the…

Q: (RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNA sample…

A: Answer ::

Q: a) Explain the effect of the guanine:cytosine ratio on melting temperature of DNA. b) The…

A: (a) Guanine : cytosine ratio is the ratio of base pairs in the DNA. There are four bases in DNA -…

Q: (a) Why can there be multiple codons for an amino acid? Why would this have evolved? (b) What is…

A: The genetic code comprises the set of rules that tells how the four nucleotide bases in the DNA are…

Q: Which of the following does not occur during telomerase extension of parental DNA? a. Translocation…

A: Introduction: Telomerase, an enzyme having RNA template, extends its ends by copying the RNA…

Q: a. Why do bacteria make restriction endonucleases? b. What is it about the endonucleases that…

A: Restriction enzymes cleave DNA at or close unique recognizing sequences known as restriction sites,…

Q: Which of the following approaches you can use to locate the relative positions of genes on…

A: Genes are located on chromosomes. These genes can not be targeted without using any specific gene…

Q: a. This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis,…

A: Gel Electrophoresis is a separation technique which is used to separate fragments like DNA, RNA or…

Q: σ factors bind to what types of sequences on DNA? a. Shine-Delgarno sequences. b. TATA box…

A: Sigma (σ) factor of RNA polymerase holozyme is a DNA binding promoter that determines transcription…

Q: Why is it important to include a selective marker gene on a plasmid? O a) So that you can select…

A: Bacteria are common source of plasmids. For the sole purpose of Cloning experiments, new plasmids…

Q: Process by which the DNA sequences encoding exons are exchanged and reordered through genetic…

A: Exon :- the coding part of the gene. Intron :- the non coding regions of pre mature mRNa.

Q: (A) After three cycles of PCR, how many DNA molecules are present that correspond precisely to the…

A: PCR stands for the polymerase chain reaction, which is used to generate larger copies of the gene of…

Q: Because DNA can only be synthesized in the 5' to 3' direction... A. The template DNA must be…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…

Q: When constructing a recombinant DNA molecule, a marker gene is used to: a. give the organism a…

A: Answer :- b. Identify whether the transformed organism contains the recombinant DNA

Q: Patients, who have a defect in one of the DNA repair systems may have what? Check All That Apply A.…

A: Any of numerous ways by which a cell maintains the integrity of its genetic code is known as DNA…

Q: Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting…

A: The process of cutting or cleaving DNA by using restriction enzymes is called digestion or…

Q: The action of ultraviolet radiation on DNA to induce mutation is the…

A: The DNA sequence is extremely important as it is used as template for replication and protein…

Q: Mismatch repair in E. coli distinguishes between old and new strands of DNA on the basis of a.…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: Predict the resulting DNA strand in the presence of a mutagen that causes the ADDITION of one…

A: During protein synthesis pathway, the N-terminus is the first component of the protein to leave the…

Q: What will most likely be the effect of the change in the DNA molecule? * A. the change will cause…

A: The DNA content of the organism represents the total genetic content and so the total genes present…

Q: Which of the following is FALSE about "classic" transposons and retrotransposons? Ac is an…

A: Barbara McClintock discovered two classes of controlling elements in maize plant known as…

Q: Describe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in…

A: The polymeric chain reaction (PCR) is a technique in which amplification of a specific DNA segment…

Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…

A: Gel electrophoresis:- it is a technique through which DNA, RNA, or protein can be separated. When we…

Q: Which of the following describes a Z-DNA helix? a. It is inhibited by methylation of bases b. It is…

A: DNA is a polymer made up of two polynucleotide chains that coil around each other to form a double…

Q: When E. coli cells are mixed with recombinant vector DNA and subject to a stress such as heat shock,…

A: Prokaryotes are the single celled organisms (unicellular) and are the simplest form, which do not…

Q: involved in the transfer of multiple drug resistance from one cell to another? * a.Transposition b.…

A: Multidrug resistance (MDR) is a condition in which the microbial cells exhibit resistance against at…

Q: When cloning a piece of DNA, the purpose of using the LacZ blue-white colony method is to A Remove…

A: Blue-white screening is a quick and efficient method for the identification of recombinant bacteria.…

Q: In the formation of recombinant DNA, a restriction endonuclease cuts a bacterial plasmid to give…

A: Recombinant DNA is a type of genetically engineered DNA which is produced to combine the best…

Q: Why is it important to include a selective marker gene on a plasmıd? a) So that you can select cells…

A: Plasmid are extrachromosomal material, self autonomously replicative, double-stranded circular DNA…

Q: During cloning, the DNA is cut with a restriction enzyme giving it what?

A: Answers: 1 - B 2 - A 3 - B 4 - B

Q: If you have G-C rich DNA versus A-T rich DNA a.Will the melting temperatures be the same/ Why?…

A: DNA is a double stranded molecule, in which two strands wind around each other like a twisted…

Q: Restriction enzymes cut double-stranded DNA _____. a. at noncoding areas between genes b.…

A: Restriction enzymes cut double-stranded only at specific sequence of the dna, producing either a…

Q: Okazaki fragments are ________. A. short RNA primers needed for initiation of polymerization…

A: Okazaki fragments are the short and newly synthsizes DNA sequnces. They are important for DNA…

Q: during bacterial transformation, DNA that enters acell is not an intact chromosome; instead it…

A: Bacterial transformation is the process of horizontal gene transfer through which some bacteria…

Q: A small DNA molecule was cleaved with several different restriction nucle- ases, and the size of…

A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…

Q: Suppose the DNA synthesis that occurs in PCR is less accurate than cellular DNA synthesis (as in,…

A: Polymerase chain response is a technique generally used to quickly make millions to billions of…

Q: Based on the banding pattern and constructed map which of the following statements is TRUE? O A. The…

A: Restriction mapping is a way of locating and identifying the unknown segments of DNA by digesting…

Q: After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’…

A: Mutations are sudden heritable changes in the genetic makeup of the cells which lead to altered…

Q: (a) Why the plasmid (containing the foreign DNA), together with the competent bacterial cells are…

A: The purpose of molecular cloning is to make numerous copies of a recombinant DNA molecule, and…

Q: PCR

A: Polymerase chain reaction is known as PCR. PCR is a technique which is used to amplify or copy the…

Concept explainers

Tissue regeneration & repair

Tissue regeneration involves the restoration of tissue components by regrowth of damaged tissues. In contrast, tissue repair involves patching of injured tissue rather than restoring it. It is the proliferative capacity of the cells that decides the amount of regeneration against the repair that would occur in the tissue. Both regeneration and repair depending on the duration of the injury and response to the inflammation.

Question

Match the E. coli mismatch repair enzyme on the left with the appropriate function on the right.

MutS
MutH
MutL

a. facilitates the looping of the region of DNA to be replaced

b. distinguish between parental and newly-synthesized DNA

c. locates mismatches in the DNA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

a. This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis, and the gel is stained with ethidium bromide. Draw a picture of the bands that will appear on the gel. b. If a mutation that alters EcoRI site 1 occurs in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? c. If mutations that alter EcoRI sites 1 and 2 occur in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? d. If 1000 bp of DNA were inserted between the two restriction sites, how would the banding pattern on the gel differ from the one that you drew in part a? e. If 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one that you drew in part a?
Indicate whether each of the following statements is true or false. If a statement is false, explain why it is false. A. The repair polymerase is the enzyme that proofreads the newly synthesized strands to ensure the accuracy of DNA replication. B. There is a single enzyme that degrades the RNA primers and lays down the corresponding DNA sequence behind it. C. DNA ligase is required to seal the sugar-phosphate backbone between all the DNA fragments on the lagging strand. D. The repair polymerase does not require the aid of the sliding clamp, because it is only synthesizing DNA over very short stretches. Answer the following questions about DNA replication. On a DNA strand that is being synthesized, which end is growing the 3' end, the 5' end, or both ends? Explain your answer. А. B. On a DNA strand that is being used as a template, where is the copying occurring relative to the replication origin-3' of the origin, 5', or both?
During DNA replication, DNA methylation: please explain answer a. A and C b. B. marks the strand not cut in mismatch repair c. A and B d. A. marks the parental DNA strand e. C. marks the strand cut in mismatch repair
Match the following type of DNA repair mechanism with the most appropriate definition. Nucleotide excision repair Homologous recombination Base excision repair Nonhomologous end joining A. Repairs thymine dimers by removing a section of the strand B. Corrects damaged bases by removing only the base C. Repairs double strand breaks by joining the ends D. Repairs double strand breaks by copying second chromosome
How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
Which of the following is NOT common to all repair mechanisms? A. Detection of the lesion B. Removal of the damaged DNA sequence/ nucleotide/ base C. Removal of free radicals at the site of injury D. Repair of the lesion E. Involvement of enzymes in removing the lesion and/or repair of the damaged sequence/nucleotide/base.
Define the following terms:a. RFCb. DNA glycosylasec. apurinic sited. apyrimidinic sitee. mismatch repair
a. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chains
A.) Damaged DNA can be reversed if nucleotides can be replaced with a proper nucleotide for a correct amino acid base. B.) Direct reversal of DNA repair can destroy the abnormal bonds of the nucleotides in the DNA sequence. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrect
Which of the following types of DNA damage would be hardest to repair using the DNA repair pathways?A. Complete removal of three nucleotides in the middle of one strand.B. A covalent bond between a base on one strand and a base on the complementary strand.C. Incorporation of a sugar other than deoxyribose into one strand.D. Covalent attachment of a short polypeptide to a single base.E. A covalent bond between a base and a deoxyribose on the same strand. Please explain why it's B
Which of the following statements describe reversal of DNA repair mechanism. A. UV light blocks the translation of mRNA beyond the damaged area B. Reversal of DNA repair mechanism requires a DNA template C. UV light is needed to initiate the formation of pyrimidine dimers D. None of the statement is correct
"The mechanism does not recruit a homologous region of DNA during repair". Explain this ?