Explain all of the options Your answer-is inoThe correct answer is: 1,2,3,5,4Which of the following is FALSE about "classic" transposons and retrotransposons?Ac is an autonomous transposable element because in contains all necessary sequences and codes for the enzymeneeded for transpositiona.O b. retrotransposons use reverse transcriptase and other enzymes to move from one location to anotherboth transposons and retrotransposons generate a short direct repeat in the region of DNA where they insertС.themselvesO d. retrotransposons have inverted repeats at the end of the transposable elementO e.transposons use the enzyme transposase to move from one location of the genome to anotherThe correct answer is: retrotransposons have inverted repeats at the end of the transposable element

Barbara McClintock discovered two classes of controlling elements in maize plant known as…

Which of the following is FALSE about "classic" transposons and retrotransposons? Ac is an autonomous transposable element because in contains all necessary sequences and codes for the enzyme needed for transposition a. b. retrotransposons use reverse transcriptase and other enzymes to move from one location to another O C. both transposons and retrotransposons generate a short direct repeat in the region of DNA where they insert themselves d. retrotransposons have inverted repeats at the end of the transposable element e. transposons use the enzyme transposase to move from one location of the genome to another

Which of the following is FALSE about "classic" transposons and retrotransposons? Ac is an autonomous transposable element because in contains all necessary sequences and codes for the enzyme needed for transposition a. b. retrotransposons use reverse transcriptase and other enzymes to move from one location to another O C. both transposons and retrotransposons generate a short direct repeat in the region of DNA where they insert themselves d. retrotransposons have inverted repeats at the end of the transposable element e. transposons use the enzyme transposase to move from one location of the genome to another

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter31: Animal Tissues And Organ Systems

Section: Chapter Questions

Problem 1CT: IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may...

See similar textbooks

Similar questions

Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
Human Biology- MILESTONE 6 X P genetics-and-biotechnology-glo O https://app.sophia.org/spcc/human-biology-2-mile -> Sophia Pathways M Gmail Purdue Global - Sig... Welcome - Login.gov UNIT 6 – MILESTONE 6 Which of the following is a gene abnormality in which two nonhomologous parts rearrange and fuse together? O Translocation O Deletion None of these, O Duplication SAVE & CONTINUE Report an issue with this question Type here to search
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
(11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of the nucleotide in the genomic DNA sequence below will be cut by Cas9 protein, which may lead to a knockout due to an error in DNA repair? The starting and the end coordinate positions of the DNA fragment on the chromosome are indicated at the beginning and end of the sequence, respectively. 110,001 ATC GGT ATC ATT GCA CTG ACC AGA GGC TAC 110,030 A) Between 110,023 (G) and 110,024 (A) B) Between 110,021 (C) and 110,022 (A) C) Between 110,020 (C) and 110,021 (C) D) Between 110,009 (C) and 110,010 (A)
THE MOLECULAR GENETICS OF CYSTIC FIBROSIS and of The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that regulates the chlorine channels in the cell membrane. This protein contains a total of 1476 amino acids so this is a small part of the entire gene. DNA Template Strand: 3'TAGTAGAAACCACAA5' 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 6th, 7th and 8th bases in the template strand of the DNA are removed, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 65
. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
Based on the following results indicate the probable chromosomal location for each enzyme. The "+" and "." signs indicate the presence or absence of human chromosome or enzyme activity respectively. Human chromosome Clone 3 7 9 11 15 18 | 20 A + - B + + + Enzyme Clone A В D E A + + + В + + + + + + + + + + N + + +
You identify a proflavin-generated allele of a genethat produces a 110-amino acid polypeptide ratherthan the usual 157-amino acid protein. After subjectingthis mutant allele to extensive proflavin mutagenesis,you are able to find a number of intragenic suppressorslocated in the part of the gene between the sequencesencoding the N terminus of the protein and the originalmutation, but no suppressors located in the regionbetween the original mutation and the sequencesencoding the usual C terminus of the protein. Whydo you think this is the case?
IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?
Fig 3.16 EcoRI SacI KpnI |ampR Aval Xmal Smal lacZ BamHI Xbal SalI Accl HincII PstI Sphl HindIII Bam H1 Bam H1 Bam H1 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can be inserted into the vector cut with BamH1 and Sma 1 maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? 3 O 4 O1 2