How can biologists explain the fact that there are 61 mRNA codons that specify an amino acid, but only 45 tRNAs? O The rules for base pairing between the third base of a codon and tRNA are flexible. O Many codons are never used, so the tRNAs that recognize them are dispensable. O Some tRNAs have anticodons that recognize four or more different codons. O The DNA codes for all 61 tRNAs, but some are then destroyed.

How can biologists explain the fact that there are 61 mRNA codons that specify an amino acid, but only 45 tRNAs? O The rules for base pairing between the third base of a codon and tRNA are flexible. O Many codons are never used, so the tRNAs that recognize them are dispensable. O Some tRNAs have anticodons that recognize four or more different codons. O The DNA codes for all 61 tRNAs, but some are then destroyed.

Name: Give typing answer with explanation and conclusion How can biologists
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give typing answer with explanation and conclusion How can biologists explain the fact that there are 61 mRNA codons thatspecify an amino acid, but only 45 tRNAs?O The rules for base pairing between the third base of a codon and tRNA areflexible.O Ma

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2CT

See similar textbooks

Similar questions

A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A frameshift mutation
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A missense mutation that is also a transversion
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A nonsense mutation
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) 1) A silent mutation that is also a transition
A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand of DNA? CCGATTG CCGAUUG GGCTAAC GGCUAAC
Which of the following statements is false about the structure of TRNA? O Because of hydrogen bonds, a tRNA actually twists and folds into a three- dimensional structure. O There are 4 base-paired regions and 3 loops in a tRNA molecule. O Flattened into one plane to reveal its base pairing, a tRNA molecule looks like a cloverleaf. O A TRNA molecule consists of a single RNA strand that is only about 80 nucleotides long. O A TRNA molecule carries an amino acid on its 5' end.
Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'
What is an anticodon, and where are they found? O a. Anticodons are complementary to codons, and are found in DNA genes O b. Anticodons are complementary to codons, and are embedded in tRNA molecules O c. Anticodons are antiparallel to codons ("backwards codons") and are found on the coding strand of the DNA gene O d. Anticodons encode amino acids and are found in mRNA molecules
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
Which of the following statements are true? Each stop codon also codes for an amino acid Each codon in mRNA codes for exactly one amino acid The start codon also codes for an amino acid Each TRNA will base pair with only one codon There are multiple codons possible for nearly all amino acids Each TRNA carries exactly one type of amino acid Each anticodon in tRNA pairs with exactly one codon Each codon in TRNA codes for exactly one amino acid
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for a protein in this mRNA?c. what stop codon is present in this mRNA?