Q: Using your knowledge of meiosis, explain why Drosophila progeny remain diploid? (2n=8)
A: The indirect process of cell division in which the chromosomes of parent cells divide once but…
Q: detail explain the experiment that helped Hershey and Chase recognize DNA as a genetic
A: Ans: Harshey and Chase studied bacteriophage, a virus that attacks bacteria. The phage samples were…
Q: Based on your knowledge of adenovirus and viruses in general, could T4 phage be used instead of…
A: I think , T4 phage could not be used instead of adenovirus. both have different life cycles and many…
Q: technique w sperm count ggs not released operly able to maintain egnancy potentially and the…
A: Ans: Reproductive issues include infertility, menstrual problems, polycystic ovary syndrome, uterine…
Q: Sexual reproduction increases variation True False
A: Sexual reproduction is the process of creating new creatures by uniting the genetic information of…
Q: Explain why only a virulent virus (like T4 phage), rather than a temperate virus, can be used in our…
A: If a virulent phage infects its host, it will produce more progeny as soon as phage DNA is injected…
Q: Was the Natufian society sustainable? Why or why not?
A: Introduction:- The Natufian society is a late Epipaleolithic archaeological culture that was found…
Q: For a cross-sectional study design that assesses the risk of developing type 2 diabetes among obese…
A: In a cross-sectional study, researcher collects data from different individuals at a given time…
Q: i) State the most appropriate type sampling technique for the following organisms. ii) Explain why…
A: The specific technique used for sampling hogweed - a type of poisonous weed is -…
Q: Which of these statements are true about predictions and hypotheses? (4 are true) □ If the results…
A: The statements which are true about hypothesis and prediction are : A) if the result of the…
Q: What does the term psychoactive mean (define psychoactive there are two criteria need to be met1?…
A: Healthy people and people with strong mental health may create positive connections with others and…
Q: Pls help ASAP.
A: Introduction Environmental Factors -- Introduction --The natural environmental factors changing day…
Q: Distinguish between Lamark’s ideas and Darwin’s theory of natural selection?
A: Natural selection is mechanism of evolution same like mutation, migration and genetic drift. Natural…
Q: 4. J. A. Moore investigated the inheritance of spotting patterns in leopard frogs. The pipiens…
A: Burnsi phenotype lacks spots on its back. Pipiens Pipiehenotype has normal spots on it's back.
Q: 3. Assume that a bacterial ribosome is spherical and has a diameter of 23nm. A. What is its volume?…
A: Ribosome is a cell organelle ,which is present in both prokaryotic and eukaryotic cell.It is known…
Q: When you measure blood pressure, the Korotkoff sounds (i.e. the sounds heard through a stethoscope)…
A: Introduction: Korotkoff sounds:- Korotkoff sounds are the sounds that medical personnel listen for…
Q: What is the purpose of this subculture procedure? In general, how is this carried out in tissue…
A: Introduction: Microbiology is the study of microbes that cause disease in humans, including their…
Q: Enumerate 5 ways in which our body repair the mismatches in the DNA replication. Stare the different…
A: Errors can occur suddenly during DNA replication. The DNA strand may be improperly inserted,…
Q: A southern European songbird, the blue tit, breeds in two habitats that differ greatly in quality.…
A: Introduction A vegetation type known as a deciduous forest that is mostly made up of broad-leaved…
Q: DNA ligase Obrings nucleotides to the nucleus seals Okazaki fragments separates the replicating…
A: Introduction DNA ligases are the enzymes that are required by all organisms to sustain the…
Q: What happens to good bacteria on your body when you wash or use anti-bacterial agents
A: Some microbes live normally on our body on the skin, these bacteria are nonharmful as well act as…
Q: b. Describe the process of oxidative phosphorylation and ETC in bacterial cells. Include the roles…
A: Cellular respiration involves production of energy from the breakdown of glucose, either in the…
Q: simple impoprtance of study on a simple cheap aquaponics
A: Aquaponics is the growing of plants and fish farming together. aquaculture + hydroponics
Q: Which protein organizes the cytoskeletons of cells along the medial-lateral axis during convergent…
A: Cytoskeleton is a dynamic network of protein filaments in the cytoplasm of cells and bacteria and…
Q: Draw a phylogenetic diagram showing the interrelationships among the following groups: Diapsida,…
A: A phylogenetic tree, sometimes called a phylogeny, is a visual representation of how several…
Q: In biology, what do you think does the garden peas has as a good model for genetic studies? A.) Few…
A:
Q: Explain and describe the pros ans cons of adenocarcinoma tumours in regards to bowel cancer.
A: Introduction: A tumor is essentially an accumulation of new tissue that serves no physiological…
Q: a) Please predict the results from the DNA gel for both samples 1 and 2 by drawing the bands in the…
A: In both the samples, there are 2 bands of lengths 4000nt and 500 nt. Because in type 2 intron…
Q: C4 and CAM plants are more efficient than C3 plants because th reduce O2 concentration. have no…
A: Introduction C3, C4, and Crassulacean acid metabolism (CAM) are the process of photosynthesis in…
Q: person who lives close to sea level and usually goes jogging in the morning. When that person runs…
A: Answer : she feel like she didn't have the energy to keep up with her usual pace because : B) her…
Q: Look for recent (2017 to 2022) scientific papers, stories, or features that demonstrate the use of…
A: Spectroscopy is an analytical method that is used for the detection of unknown compounds. In the…
Q: The nervous system of the Hydra is _______ _______ while the flatworm’s is ________ _________.…
A: Introduction In terms of biology, symmetry is referred to as the repetition of parts in animals or…
Q: On the histologic section of the glands stomach's fundus, relatively large electron-microscopically…
A: The four anatomical regions of the stomach are the cardia, fundus, body, and pylorus. However, there…
Q: Examine the equation below? H₂O%202 + 2 H+ + 2 e- a) What process is illustrated above and where…
A: Photosynthesis is a process in which glucose is synthesized from water and carbon dioxide using…
Q: Draw liver cells through a microscope
A: Liver contain lipid droplets, which secrete extra cellular matrix proteins. *The activation of…
Q: LISTEN Many vaccines are heat sensitive due to their high concentration of proteins. Which of the…
A: Vaccines are chemical that is synthesized or prepared to kill or fight infections in the body.…
Q: Pls help ASAP.
A: Recombinant DNA is the piece of DNA fragment, which were produced by atleast two or more fragments…
Q: Choose all that apply. This molecule is O O-P-O-P-O-P-O- O™ OIPIO O one of the building blocks of…
A: Within a live body, macromolecules have specific structures and functions. In living things, several…
Q: The PCR reaction contains deoxynucleotide triphosphates (dNTPs) in order to construct new DNA. There…
A: PCR is a sensitive technique which helps in making rapid amplification of a specific DNA segment.…
Q: How would you answer part c and d?
A: c). In the phylogenetic divergence of the bear through the epoch clade, polar bear and brown bear…
Q: When cations and anions meet they Group of answer choices A) repel. B) form ionic bonds. C) form…
A: Introduction: A cation and an anion form an ionic bond, which is a charged atom that has the ability…
Q: What is the difference between infection and disease? Name one example to help illustrate the…
A: Please follow steps 2 & 3 for detailed explanation.
Q: 7. Please label the structures (including orientation i.e. Right/Left) indicated on the CT scan of…
A: CT scan of pelvis in female shows the cross-sectional region between the hip bones using X-rays. The…
Q: Electrolytes that release hydrogen ions in water are Group of answer choices A) bases. B)…
A: Answer: Acids are chemical substances that react with water to release hydrogen ions (H+). For…
Q: Which of these molecules is NOT part of the light-dependent reaction? 02. b. H₂. H₂O. d. NADPH. e.…
A: Introduction: Since photosynthesis is an oxidation-reduction process including a light phase and…
Q: When you measure blood pressure, the Korotkoff sounds (i.e. the sounds heard through a stethoscope)…
A: We know that In the human body, blood pressure is considered as the pressure exerted by the blood on…
Q: You generate several temperature sensitive mutant strains of bacteria. To study what genes might be…
A: Introduction :- Bacterial mutants frequently lose a growth characteristic (such as the inability to…
Q: What are the Importance of the origins of amniotes?
A: All fully terrestrial vertebrates are classified as amniotes, which also includes all living reptile…
Q: In mice, the gene C for colored fur is dominant over its allele c for white. The gene B for normal…
A: Introduction Genetics makes a distinction between genotype and phenotype. An organism's entire…
Q: Why is reproducibility of pipetting critical in performing serial dilutions?
A: Introduction :- The movement of liquids from one place to another would be risky and messy without a…
Step by step
Solved in 4 steps
- which is (select al) false about specto scopy? needs to re-auto zero 9) one 51 The Same chemical has the same molor absorpHw' at diff.lergth chem'i cal has diffe mo lar absorpticit C) The at diff wae length Same d) A protein solo. is colorten f there fore it does wareleng th max, not haveEosin Y Test solution procedure in preparationoption isoelectric focusinggel filtrationsalting outdifferential centrifugationEdman degradationion exchangedialysis
- Glycerin on microscope slides serves forSulfur Indole Motility (SIM) Medium H2S produced, color and +/-: ______________________________ Indole present/Tryptophan hydrolysis, color and +/-: ___________________________ Motile or non-motile: _____________________________A PhD student leaving for vacation has asked an undergraduate student to perform daily media changes forhis iPSCs while he is gone. The culture is happening in 12-well plates where a volume of 2 mL is optimal. OnSaturday, when changing the media, the undergraduate decides to add 4 ml of media to the dishes (insteadof 2 ml) because he wants to skip lab and watch the Super Bowl on Sunday. He decides to add twice thevolume of media (4 mL) to tide the cells over till Monday. However, when the graduate student returns onMonday, he finds that some of his cells have died. Your job is to determine whether the cells died due to alack of oxygen. For the calculations that follow, diffusion and reaction occurs only in one direction. Also,assume that reaction only occurs at the cell-media interface. Use Michaelis-Menten type kinetics for oxygenuptake. You may use the following information:Ps = 150 mmHg (ambient oxygen tension)K = 1.19 nmol / mL / mmHg (solubility of oxygen in medium)D = 2…
- A PhD student leaving for vacation has asked an undergraduate student to perform daily media changes forhis iPSCs while he is gone. The culture is happening in 12-well plates where a volume of 2 mL is optimal. OnSaturday, when changing the media, the undergraduate decides to add 4 ml of media to the dishes (insteadof 2 ml) because he wants to skip lab and watch the Super Bowl on Sunday. He decides to add twice thevolume of media (4 mL) to tide the cells over till Monday. However, when the graduate student returns onMonday, he finds that some of his cells have died. Your job is to determine whether the cells died due to alack of oxygen. For the calculations that follow, diffusion and reaction occurs only in one direction. Also,assume that reaction only occurs at the cell-media interface. Use Michaelis-Menten type kinetics for oxygenuptake. You may use the following information:Ps = 150 mmHg (ambient oxygen tension)K = 1.19 nmol / mL / mmHg (solubility of oxygen in medium)D = 2…A PhD student leaving for vacation has asked an undergraduate student to perform daily media changes forhis iPSCs while he is gone. The culture is happening in 12-well plates where a volume of 2 mL is optimal. OnSaturday, when changing the media, the undergraduate decides to add 4 ml of media to the dishes (insteadof 2 ml) because he wants to skip lab and watch the Super Bowl on Sunday. He decides to add twice thevolume of media (4 mL) to tide the cells over till Monday. However, when the graduate student returns onMonday, he finds that some of his cells have died. Your job is to determine whether the cells died due to alack of oxygen. For the calculations that follow, diffusion and reaction occurs only in one direction. Also,assume that reaction only occurs at the cell-media interface. Use Michaelis-Menten type kinetics for oxygenuptake. You may use the following information:Ps = 150 mmHg (ambient oxygen tension)K = 1.19 nmol / mL / mmHg (solubility of oxygen in medium)D = 2…HonorSociety org č. * SpiasiLa * Maps New Tab Describe your color observations of the Nitrate test. a. after adding Reagents A, B (and/or znic): cements b. Did the organism reduce nitrate? (yes or no) ments c. Is the final product nitrate, nitrite or ammonia/nitrogen gas? sions ing es Question 13 4 pts y Resources ules Based on your observations of the SIM test: ple a. Did sulfur reduction occur (yes/no)? zes b. Did the organism produce the enzyme tryptophanase (yes/no)? abus m c. Is the organism positive or negative for the motility test?
- File guft 1.yt Machine Cochise14ee7 Lane 0 Pmer. DTarPOPD mob Comment 17703 Spacing 15.06 Siga C 17A 4 G 2 Bases 0 an 2004 Gelstat ime123 219 20 30 60 70 NNACTCA TCTOGTGGA TTC CTA TCCTG AC A AG TGATGTG CAAAC TG GTAACTC TG AG GCAGATAAC CA G GG CA AA AAGGTG TATAAG 100 110 140 100 CAGA AG TC CGGA AA A TCA TT TAA 170 TAAA ACA AAGCCCTAACT TG GAAG AAGT TCA GTTTTACACA TCT TTA TA TG GAGAGAA 180 TAT TCTAT TA ATOTCCTGT TA TATT TG TCA TATTCA TA CAGT TGTCACAGTATATT TCAAAC CA AC TG TTTAAAA ACAAAC TO AAATAAA 210 230 240 260 270 AAATTTAAATACCCT TA TG TA AA ATAG GCT TC CC TG GTG GCTCAG GG GTAAAAA ACTCGC CCGC CA ACGCAG GAGATGTAGAT TTGATC CCT 300 310 340 350 410 430 440 GG GT TAG GA AG icCCTa GAGA AGGAAATGAAAAAC CACTCTAG TAT TCT Tac CTG GG AAATC CCA TGGACAG AG GAGCOTO GAG G Gc 490 500 SI0 530 TACAGTCCATGGGAGTCGCAA A AGAGT TG GACATG ACTAA ACA ACAACATATAAAATAACCT TACTC CATAATGTCAAACT TATOTCACAC S40 AAA ATGCAA AGT TCT TACATCTAT TAACTTTTATGOT TAAATATA ACCTAATGCACTOTTT TATACAGCA ACAACTACT TT TT TATTT TAAA…1 %Ar l. docs.google.com/forms/d/e O 1. False Endospores can be inactivated by high pressure and high temperature. O True O False The bacterial capsule is known to be highly resistant to various forms of radiation and other physical and chemical agents. * O True O False Aldehyde has a broad spectrum of activity against bacteria, fungi and viruses, and can العربية الإنجليزيةWT E. coli B Lysate titer on B K pfu/ml 10⁹ 10⁹ 0.1 m.u. 0.2 m.u. 0.5 m.u. 1.0 m.u. rll#x 2.0 m.u. E. coli B Lysate titer on B K 10⁹ 103 ril#y E. coli B Lysate titer on B 10⁹ K 10² rll#x E. coli B Mutations rll#x and rll#y are separated by how many map units? Lysate titer on ril#y B K 10⁹ 107