Choose all that apply. This molecule isO||O-P-O-P-O-P-O-0Oa lipidO™one of the building blocks of proteina nucleotide triphosphateATPone of the building blocks of RNAa proteinO™one of the building blocks of DNAa nucleic acida carbohydratethe energy currency of the cellan amino acidOIPIOоO™NH₂NOH OHNN

Within a live body, macromolecules have specific structures and functions. In living things, several…

Choose all that apply. This molecule is O O-P-O-P-O-P-O- O™ OIPIO O one of the building blocks of protein a nucleotide triphosphate O one of the building blocks of RNA O a lipid ATP O a protein one of the building blocks of DNA a nucleic acid O a carbohydrate O the energy currency of the cell O an amino acid O™ N H₂N OH OH N

Choose all that apply. This molecule is O O-P-O-P-O-P-O- O™ OIPIO O one of the building blocks of protein a nucleotide triphosphate O one of the building blocks of RNA O a lipid ATP O a protein one of the building blocks of DNA a nucleic acid O a carbohydrate O the energy currency of the cell O an amino acid O™ N H₂N OH OH N

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 17P: Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX,...

See similar textbooks

Similar questions

. A protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3 Cys residues, located as shown below. Only one of the Cys has a free - SH group and the other two are involved in an -s-s- bond. A Phe Cys « N-terminus Cys- - Met Cys- C-terminus The only methionine and the only aromatic amino acid (Phe) in this protein are in the positions indicated. Cleavage of the intact protein (i.e., with disulfide bonds intact) by either cyanogen bromide or chymotrypsin does not break the protein into two peptides. Where is the -s-s- bond (i.e., AB, BC, or AC)?
This is DNA. Locate the nitrogen bases (nitrogens are blue). Where are they located in the molecule?Locate the sugars and phosphates, and describe their location. Adjacent nucleotides are linked by covalent phosphodiester bonds (-O-P-O-) produced by a condensation reaction. What parts of the adjacent nucleotides are linked by phosphodiester bonds?Two nitrogenous bases extending towards the middle of the double helix. Are there any covalent bonds between these bases?If there are no covalent bonds between these bases, what other kinds of bonds might hold the two strands of the double helix together?
Preview attachmen.. 63 62 GI GGU G5 G 4 W AUG GCC AUG CUC CUC UUC GAG ACG UAC CGG R (thế strand) [+] CUC GAG AAG The circled portion labeled Y is known as a(n): O ribosome O DNA molecule O codon O tRNA molecule O anticodon the « Previous Next > & 5 6 7 8. u
B W S sult, it makes the protein Why is denaturing the proteins necessary for SDS PAGE to work? Use YOUR OWN X mand 3 E D с $ R F 5 Lê 6 T G MacBook Pro B Y H U N J 8 I M 9 K O I O L 44 P command . : 8 ; x { + C option ? I } 1 M
10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
7 Protein structure.Circle one of the three amino acid sequences that is most likely to form a stable a-helix? RASKTARQ DASKTAEQ KPGKPAGQ In one sentence (that can be accompanied by a small picture) explain why?
This activity breaks down protein synthesis using the metaphor of PIZZA! Use your Amino Acids Reference Sheet to complete the following table. Fill in the blank spaces of each row with either the missing DNA triplet, the mRNA codon, or the Amino Acid. While there are actually multiple codons that code for any one amino acid, for this activity there only needs to be one DNA triplet and one corresponding mRNA codon recorded for each amino acid. Remember: RNA uses uracil (U) instead of thymine (T)! TTG GGG CGT AAA TTT CAA DNA AAC UAU CAC GCA AAA mRNA codon Asparagine Proline Tyrosine Amino Acid Histidine
Drag each amino acid into the box corresponding to its classification. Reset Help NH2 c=NH2 с-с-N-н HỆN- COO" NH CH2 CH, CH2 CH2 CH2 CH2 H,N-C-coo H. E CH2 H3N-C-COC H,N H Polar non-charged Polar negatively-charged Non-polar Polar positively-charged
Copy of mom it for. V Maps G old Telephone Ima. O Preview attachmen.. G3 62 GI GGU G 4 W AUG GCC AUG GAG CUC UUC ACG UAC CGG R (Ihe strand) GAG AAG The circled structure labeled X is known as a(n): O TRNA molecule O codon O MRNA molecule O ribosome O DNA molecule « Previous Next & 5 7 8. 9
DO NOT COPY OLDER ANSWERS! AND SHOW FULL WORK! I have a mixture of 4 proteins, whose sequences are shown below (note that each protein is a 100-repeat of the sequence shown). Protein A: (Gly-Ala-Lys-Val-Ile-Phe-Glu-Val-Asn-Gly) Protein B: (Ala-Ala-Lys-Arg-Ile-His-Glu-Ala-Asn-Lys) Protein C: (Glu-Val-His-Asp-Ala-Asp-Glu-Val-Asn-Asp) Protein D: (Ala-Lys-Arg-Phe-Trp-Phe-Gly-Ile-Ala-Gly) 1) Which protein/s are MOST LIKELY to precipitate out at a pH of 3.5? a) A b) B c) C d) D e) B & C f) A & D g) None of them h) Cannot be determined.
My PDB code: 3GRS residue point: HIS467 mutation: LEU Describe why this position in your protein is important and outline the effects the mutation will have on the 3D structure and the function of your protein. (up to 50 words)