Q: Electrolytes that release hydrogen ions in water are Group of answer choices A) bases. B)…
A: Answer: Acids are chemical substances that react with water to release hydrogen ions (H+). For…
Q: How do populations grow in size? How does Darwin explain this? If you wish you may include a…
A:
Q: measure of the productivity of photosynthesis is the rate of water production. heat production.…
A: Photosynthesis is a process which is carried out by primary producers that is plants. They prepare…
Q: On the histologic section of the glands stomach's fundus, relatively large electron-microscopically…
A: The four anatomical regions of the stomach are the cardia, fundus, body, and pylorus. However, there…
Q: Explain and describe the pros ans cons of adenocarcinoma tumours in regards to bowel cancer.
A: Introduction: A tumor is essentially an accumulation of new tissue that serves no physiological…
Q: Which of the following is matched correctly? DNA helicase: unwinds DNA prior to transcription DNA…
A: The heterocatalytic process, by which a new DNA strand is synthesized on a old DNA template is known…
Q: What cells inside our bodies would be affected if you ingested a suspension of T4 phage? Describe…
A: Bacteriophage T4 possesses both "early" and "late" genes. This categorization indicates that these…
Q: Classify statements about the eye as true or false. True The iris regulates the amount of light that…
A: Introduction :- The coloured portion of your eye is called the iris. The tiny, black opening that…
Q: Oxidized/Reduced state has more free energy than when it is in the Oxidized/Reduced state.
A: Ans: Oxidation occurs when a molecule looses its election or gain oxygen while reduction occurs when…
Q: On the histological preparation of the walls of the small intestine: there * are groups of cells at…
A: Similar to the rest of the GI tract, the wall of the small intestine has 4 main layers: the mucosa,…
Q: How does temperature affect how lactase drops work to break down lactose into glucose and galactose?
A: Disclaimer: - Out of the numerous questions present, the highlighted one will be answered. Please…
Q: Secondary metabolites produced by the microorganisms have resulted in the production of antibiotics.…
A: Microorganisms produce two types of metabolites namely, primary metabolites and secondary…
Q: A homozygous fly with two recessive mutations causing purple body and short wings (ppss) is mated…
A: Introduction : Haplotype refers to a group of HLA genes found on a certain chromosome. These genes…
Q: Discuss any 1 gene regulation mechanism. Describe the gene expression in this type of gene…
A: introduction : Gene expression is the process of turning genetic information into a functioning…
Q: 8 9 10 The primary purpose of the middle ear bony structures (maleus, incus, and stapes) is to A.…
A: inner ear, also called labyrinth of the ear, part of the ear that contains organs of the senses of…
Q: Apart from trying to clean up the ocean garbage patches, what other approaches should humans be…
A: Introduction : A gyre, or vast concentration of trash produced by humans, is what's known as a…
Q: Suppose we would want to have mirrored lateral sides (meaning both the left and right portion are…
A: The majority of animals have bilateral symmetry. They have anterior-posterior (A-P) and the…
Q: Explain Gene Expression Microarrays and RNA-seq in Transcriptome Analysis as detailed and thoroughly…
A: The fundamental distinction between RNA Seq and microarray is that the former allows the analysis of…
Q: Identify the two categories of lymphoid organs and their roles in the body's immune response.…
A: The maturation and multiplication of lymphocytes occur in lymphoid organs, which support the…
Q: Was the Natufian society sustainable? Why or why not?
A: Introduction:- The Natufian society is a late Epipaleolithic archaeological culture that was found…
Q: What problems does Digestion solve
A: Digestion is a physiological process in which complex food materials is broken down into simpler…
Q: Caspar's genotype is HhRr. These genes are located on the same chromosome, so the haplotype is: H…
A: Meiosis is the cell division process that involves production of four haploid (n) daughter cells…
Q: How many Y chromosomes are there in an individual with Klinefelter syndrome? 0 1 2 3 4 CHOOSE ONE
A: Chromosomal aneuploidy arises due to non-disjunction ( failure of segregation of chromosomes )…
Q: effects of scaling are beneficial to small creatures Choose the correct answer: that get wet. that…
A: The answer is “that fall from great heights”
Q: I am stuck on a question about cell growth signaling and RTKs. If phosphatase is nonfunctional,…
A: Growth factor signaling is mediated by receptor tyrosine kinase mediated pathway. RTK is a…
Q: Why do we need to kill bacteria in order to clean an object?
A: Bacteria are prokaryotes which have exponential growth pattern and are responsible for causing…
Q: What is a taxon? What is the plural of “taxon”?
A: Introduction Taxonomy/Scientific categorization is the study of naming, depicting, and…
Q: Define and describe mechanisms of habituation, sensitization and memory as seen in Aplysia
A: It is essential to understand animal behavior under the influence of external stimuli. The response…
Q: 1a) Why do you have to rinse the entire gel apparatus with distilled water after running the gel?…
A: The gel electrophoresis is a method of molecular biology for the separation and analysis of…
Q: Why is reproducibility of pipetting critical in performing serial dilutions?
A: Introduction :- The movement of liquids from one place to another would be risky and messy without a…
Q: Distinguish between Lamark’s ideas and Darwin’s theory of natural selection?
A: Natural selection is mechanism of evolution same like mutation, migration and genetic drift. Natural…
Q: 3.4 L = ml
A: Introduction The metric system is an internationally agreed-upon measurement system supported by…
Q: TRUE OR FALSE A stem cell can reproduce itself indefinitely and differentiate into specialized…
A: Cell is a structural and functional unit of life. It is present in all living organisms.
Q: Stanley Miller’s classic experiment suggests that ______ ______ of organic compounds may have been…
A: Scientists estimate that the universe is around thirteen thousand eight hundred and twenty billion…
Q: In PCR , the primers will determine which gene will amplified (copied) . in lab we’re doing qRT- PCR…
A: One of the most used techniques for quantitatively estimating gene expression is qRT-PCR, often…
Q: Which of the following is involved in recombinant DNA technology? Explain. a. DNA polymerase b.…
A: Ans: Recombinant DNA technology is the process in which sequences derived from different sources are…
Q: what happens in the circulatory system when altitudes are low and high?
A: External and internal factors influence blood pressure. Internal factors like age, gender, and…
Q: A southern European songbird, the blue tit, breeds in two habitats that differ greatly in quality.…
A: Introduction A vegetation type known as a deciduous forest that is mostly made up of broad-leaved…
Q: 70. A 68-year-oldman with chronic respiratoryacidosis has an arterial pHof 7.34 and an arterial PCO2…
A: When the lungs are unable to completely expel the carbon dioxide that the body creates, a condition…
Q: What could the overuse of anti-bacterial agents lead to?
A: Bacteria is unicellular prokaryotic organisms containing primitive nucleus that can survive under…
Q: 1. In cats, long hair is recessive to short hair. A true- breeding (homozygous) short-haired male is…
A:
Q: critically review the evidence for and against the importance of inflammatory response genes in…
A: Hereditary history, age, diabetes, obesity, past smoking history, and alcoholism are typical…
Q: It is correct to assume action by the adaptive defense when: O antibodies are produced. specificity…
A: 1) The first statement is incorrect and rest all are correct i,e the lymphatic vessels are not…
Q: Suggest TWO (2) commonly available biomass in Malaysia that can be utilized as potential feedstocks…
A: Malaysia has a very potential for biomass energy uthilization. Its equitorial climate that is ideal…
Q: Which of the four alcohols (Propanol, Ethanol, Butanol and Methanol) was the most effective in…
A: Phospholipid bilayers make up cell membranes, which are typically represented by the "fluid mosaic…
Q: 4. J. A. Moore investigated the inheritance of spotting patterns in leopard frogs. The pipiens…
A: Burnsi phenotype lacks spots on its back. Pipiens Pipiehenotype has normal spots on it's back.
Q: Sexual reproduction increases variation True False
A: Sexual reproduction is the process of creating new creatures by uniting the genetic information of…
Q: What is the function of the Helper T cell in both humoral and CMI responses?
A: Adaptive immunity, which develops exclusively in vertebrates after exposure to agents such as…
Q: It would seem that you only need one set of instructions for your body to do all the jobs it needs…
A: Introduction A biological cell is a hub of biochemical activities. Numerous physiological and…
Q: Identify two types of cells. Describe the identification of cells and the cell's other qualitative…
A: Eukaryotic cells with large central vacuoles, cellulose-containing cell walls, and plastids such as…
Step by step
Solved in 2 steps
- Microarray hybridization is used mostly in transcript profiling or assaying DNA variation. Although the technology for establishing DNA microarrays was developed only recently, numerous applications have already been developed and their impact on future biomedical research and diagnostic approaches is expected to be profound. Give some examples of the practical use of this technique.Ehat primer sets could be amplify the following DNA sequence? AATACGTCGCATGGggatccttttttatgcatgThe best molecular technique to quantify the gene transcripts is (write in full).
- In selecting target cells to receive a transferred gene in gene therapy, what factors do you think would have to be taken into account?Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?Briefly explain how synthetic probes are created to screen a DNA library when the protein encoded by the gene is known.
- RNA sequencing can detect DNA mutations typically easier to analyze can detect transcripts with very low abundance Both Answer Bank used for gene-expression analysis Microarray requires transcript-specific probesThe enzymes mentioned below are used as tools during cloning, DNA sequencing and/or gene therapy. Explain what they are used for. Also mention the actual biological function of the respective enzymes. 1) RNaseHEcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3
- In biotechnology, gene cloning is a very important technique. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is the plasmid. State the three (3) important regions of the plasmid. Elaborate your answer.Briefly explain why RNA-seq gives more information about the transcriptome than does microarray analysis.Why is genome editing by CRISPR-Cas advantageous over traditionalmethods for creating knockout or transgenic animals?Explain your answers.