Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…
A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…
Q: Read the Guilty dentist information. Then use your understanding to answer the following questions…
A: In various research studies, people assume or predict to certain cause and effects called variables.…
Q: The physician has ordered acetaminophen every 6 hours for a child weighing 10 lbs. The…
A: Recommended low dosage of acetaminophen= 200mg/kg/24hrs Weight of the child= 10lbs= 4.5kg
Q: Which of the following are reproductive organs? Select all that apply A. Root B. Leaf C. Stem…
A: In plants, which organs are directly responsible for sexual reproduction, or take part in sexual…
Q: In relation to NSAIDs, describe the mechanism of how tissue damage leads to pain and how NSAIDs,…
A: Nonsteroidal anti-inflammatory drugs, or NSAIDs, are a widely used class of medications that are…
Q: Patient is in severe stomach distress and is unable to swallow any meds due to vomiting, precise…
A: There are several routes of administration for drugs, including: Oral: This is the most common…
Q: explain the steps of what might happen inside a healthy mammary gland epithelial cell after it is…
A: UV light, or ultraviolet light, is a type of electromagnetic radiation with a wavelength that is…
Q: The identity of Kim's biological father is unknown, but it is thought to be either Kevin or Thomas.…
A: DNA fingerprinting is a method of identifying an individual based on their unique DNA pattern. It…
Q: A child weighing 28 pounds is to receive acetaminophen for fever and pain. The recommendations for…
A: Given that weight of the child is 28 pounds. Therefore, weight in kg's = 28 × 0.454 = 12.7 (Because…
Q: Explain how the disruptions in the electron transport chain leads to the production of reactive…
A: The electron transport chain is a series of protein complexes and electron carriers that are located…
Q: The Tropical regions are likely to have more biological diversity than the Temperate ones. Give two…
A: Biome is the distinct ecological community of animals and plants that exist together in a particular…
Q: Lipids most abundant form are Triglycerides building blocks are 1 If a triglyceride only contains…
A: Introduction:- Lipids and Proteins are categorised under bio-macromolecules. Proteins are higher…
Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…
A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…
Q: Name a drug for treatment for overactive bladder syndrome which does not target the muscarinic M3…
A: Overactive Bladder Syndrome or OAB is a medical condition in which the ability of the urinary…
Q: What does MRSA stand
A: Bacteria are diverse kinds of unicellular organisms belonging to the domain prokaryote because they…
Q: Dihybrid Crosses - Genotypes NOW YOU KNOW THE RULES - FOR EACH PHENOTYPE SHOWN IN THE PICTURES, WORK…
A: Introduction A gene exists in two alternative forms known as allele. When both the alleles are same,…
Q: 1. Identify and explain the differences in organelles and energy sources between cellular…
A: Answer : photosynthesis and cellular respiration are two different processes photosynthesis occurs…
Q: What happens when large natural and/or man-made deforestation occur? How does the plant control the…
A: The epidermis of plant cells has specialized openings called stomata. They are crucial to the carbon…
Q: Why is there loss of protein synthesis in hypoxic injury to a cell?
A: Protein synthesis is the process by which cells use genetic information to build and assemble…
Q: List 4 factors that increase O2 extraction to the tissues (muscles).
A: Exercise hyperemia is the term used to describe the increase in blood flow to the skeletal muscles…
Q: Considering both habitat conditions and requirements for successful symbiosis, why should you be…
A: The question is asking about the potential similarities in the microbial symbiots found in two very…
Q: typical prokaryotic cell has about 3,000 genes in its DNA, while a human cell has almost 21,000…
A: Similar genes present in two different organisms is suggestive of some common features that occur in…
Q: Describe and drawing the reproductive cycle of the fungus Penicillium notatum
A: Penicillium reproduces both asexually and sexually. The asexual stage however, is dominant and…
Q: 1. Do you think it is important to understand evolution? List three different ways that evolution…
A: The concept of evolution was given by two scientists Darwin and Wallace. It was based on natural…
Q: 19. In the leaves of most plants, where can chloroplasts be found? a. b. C. d. in the upper…
A: A membrane-bound organelle called a plastid, or chloroplast, is a type that primarily facilitates…
Q: How can you distinguish growth from development?
A: Life starts with a single cell and becomes a complex organism during the course of growth and…
Q: How does pollination take place in water hyacinth and water lily
A: Pollination: The process of transfer of the pollen grains from the anther which is the male…
Q: What are the genotype and phenotype ratios of the potential offspring when a man who has type A…
A: There are phenotypically 4 types of blood group- Type A, Type B, Type AB and Type O. Type A can be…
Q: Do athletes want a higher or lower VO2max? Explain
A: Introduction: The maximal rate at which our bodies can consume oxygen during exercise is known as…
Q: Table 2. Week 53 in Mars greenhouse. H Environmental data at 12:00 p.m. Note from Luke: I don't…
A: The above question is referring to environmental data collected in a Mars greenhouse during week 53.…
Q: peptide bond Primary Structure Secondary Structure Tertiary Structure NH3+ Quatern Structur 2. Using…
A: Amino acids sequences linked together by peptide bonds form the primary structure of a protein. Any…
Q: How can you tell if a protein is stably expressed over time by looking at a pulse-chase analysis gel…
A: Pulse-chase analysis is a method used to study protein synthesis and turnover in cells. In this…
Q: The reason LacZ is frequently used as a reporter gene is: a. The lacZ gene product binds to the…
A: LacZ is a gene of lac operon which codes for β-galactosidase. The reporter genes cause a visible…
Q: HO ↑ A CH3 B choline head group H3C. C glycerol backbone CH3 CH3 < CH3 B- CH3- CH3 C-CH₂-CH O O C 0…
A: A= Sterol group B= Choline C = Glycerol D = Acyl chain
Q: Describe the reason that free chlorine-based solutions and technologies are ineffective against…
A: Introduction: The parasite Cryptosporidium parvum is the cause of the severe diarrheal disease…
Q: Explain this statement "In a sense, the life cycle in the organism".
A: Understanding the life cycle of an organism can help us understand its behavior, ecology, and…
Q: Explain the Life cycle of Plasmodium starting from its entry in the body of female Anopheles till…
A: Plasmodium requires two host for completion of its life cycle a primary and secondary host. That is…
Q: What is the arthropod's role in disease transmission such as malaria? Question 7 options: a)…
A: Arthropods, especially ticks and mosquitoes, are responsible for a number of parasitic and viral…
Q: What is a repetitive element in genomics? What are the types of repetitive elements? What is their…
A: The amount of DNA present in a cell of a person is called as genome. DNA is made up of nucleotides…
Q: Explain the importance of differential gene expression. Why don't cells and organisms simply express…
A: Gene expression is the process by which a gene's information is used to create a functional gene…
Q: Which of the following is NOT true of ionic bonds? They are formed because of the mutual attraction…
A: Ionic bond is also known as electrovalent bond. It is the complete transfer of valence electrons…
Q: Which of the following is generally true about eukaryotic gene regulatory regions? a. All regulatory…
A: Genes are the segments of DNA that code for polypeptide chains. The expression of the genes in…
Q: An experiment was conducted looking at the likelihood to get covid when you are not vaccinated,…
A: The independent variable is the variable that is changed or manipulated by the researcher.
Q: Which of the following groupings of the abdominopelvic regions is medial? a. Hypochondriac,…
A: The ability to correctly interpret an X-ray film is crucial for medical professionals in order to…
Q: Give an example of this question and explain this question: add image if needed to better explain…
A: Our body is made up of multiple organs. Different organs together form a system and carry out a…
Q: Unlock Your Answer the following questions. Explain your answer by citing references and evidence.…
A: The chemical process known as photosynthesis is used by plants, algae, and some bacteria to convert…
Q: In your own words , Explain the structure of the nasal cavity, trachea and alveoli. Linking their…
A: Introduction:- The primary function of the respiratory system's major organs are to eliminate carbon…
Q: What is the difference between coagulatiive and liquefactive necrosis? How are they related to…
A: Necrosis is referred to unprogrammed cell death due to a disease or an injury. It can affect many…
Q: Biological Macromolecules, Fill in the blank: Elements Present C,H,O Macromolecule Carbohydrates…
A: Molecules such as carbohydrates, fats, proteins and nucleic acids are all different types of…
Q: explain this image for the ecoli bacteria mutation trpE
A: Introduction The trp operon is a type of operon system found in E. coli bacteria. The trp operon…
1. Compare and contrast diabetes mellitus and diabetes insipidus.
Step by step
Solved in 2 steps
- 1. type 2 diabetes using your own words, provide a clear but complete and accurate explanation of the DDC2. Enlist some of the conditions that can be observed due to hyposecretion of insulin.1. What factors put someone at the greatest risk for type 2 diabetes? What are the common symptoms of type 1 and type 2 diabetes? 2. What tests are commonly used to diagnose diabetes? What are some of the treatments for diabetes? How do people with diabetes monitor their blood glucose levels?