Click the "draw structure" button to launch the drawing utility. Draw the structure of the deoxyribonucleotide formed by joining two deoxyguanosine 5'-phosphates together. food window open
Q: A major pathway for metabolism of ethanol is shown below. Humans consuming a large fraction of their…
A: Glycolysis is enzymatic conversion of glucose to pyruvate with concomitant reduction of NAD to NADH…
Q: (Theme 5) You are testing the role of three proteins (Protein A, Protein B, and Protein C) which…
A: The electrophoretic gel electrophoresis mobility shift assay is also known as EMSA.This assay is…
Q: Sarin is an inhibitor of acetylcholinesterase. Draw a mechanism that shows this.
A: Before going into the mechanism by which sarin inhibits acetylcholinesterase, we need to know a bit…
Q: Proto-oncogenes are genes that have the potential to become oncogenes through either mutation or an…
A: Genes are the segments of DNA that code for proteins. These are passed from parents to offspring. A…
Q: How many oxygen atoms are reduced from each nadh and fadh
A: By the end of citric acid cycle most of the energy has been converted into high energy electrons in…
Q: Fill the sentence in with the right keyword: Anabolic reactions Sometimes or Alwasys consume energy.
A: When a chemical reaction takes place energy is either taken in or released. Depending on the…
Q: The approximate composition of coconut oil (mp 24-25 °C) is listed below (data according to…
A: The biochemical composition of coconut oil consists primarily of triglycerides, which are esters…
Q: 5. ANSWER THE FOLLOWING PROBLEM AND EXPLAIN YOUR ANSWER FOR BETTER UNDERSTANDING. Fill in the blanks…
A: Amino acids are biomolecules that have a hydrogen, a carboxyl group, an amino group and a chemically…
Q: Lipid storage droplets are the only human organelle known that is bound by phospholipid monolayer…
A: A lipid monolayer is a single layer of lipid molecules that forms at the interface between two…
Q: For a reaction that proceeds spontaneously from reactants to products, the AG is O less than 0 00 O…
A: Gibbs Free Energy is a thermodynamic function that not only is related to spontaneity but also deals…
Q: Match each characteristic to the appropriate process. Anabolic process breaks down macromolecules…
A: Metabolism is the sum total of all chemical reactions taking place in lifeforms. It can be divided…
Q: RNase Q is an enzyme that has identical activity to RNase A, but is found only in a group of humans…
A: There are four classes of biological macromolecules: nucleic acid, proteins, lipids and…
Q: Suppose a researcher previously cloned gene Y into M13 bacteriophage vector. Gene Y encodes a…
A: In order to solve this problem, first we need to find the amino acid sequence of the wild (original)…
Q: The Bohr effect describes the impact of changes in serum pH and CO2 concentrations on the oxygen…
A: Hemoglobin is an oxygen-binding protein that transports oxygen from lungs to the tissue. The…
Q: You happen to pass a bar. Distracted by your entrance into the bar, one of the humans inadvertently…
A: Ethanol and methanol are both first metabolized by the same enzyme, alcohol dehydrogenase. The…
Q: We humans do not express an alpha-Galactosidase enzyme and therefore cannot break down stachyose but…
A: Stachyose is a tetrasaccharide made up of two , one and one . Stachyose can be represented as .Gal…
Q: Question 9 Use the following information to answer Questions 9 and Part c.Consider the reduction of…
A: Stereoisomers are isomers that have the same molecular formula, same connectivity of atoms but…
Q: This is an group activity, your task is to create a table to summarize the ATP count for the listed…
A: Here galactose is the starting substrate to undergo oxidative catabolism to produce energy in the…
Q: Describe ketone bodies and their role in metabolism.
A: Ketone bodies are a group of three water-soluble compounds: acetoacetate, beta-hydroxybutyrate and…
Q: Which of the statement is true regarding km in the Michaelis-Menten equation? It is a measure of the…
A: Enzymes are proteins that catalyze biochemical reactions. For a single substrate enzyme that has a…
Q: Which of the following is true of anabolism: Anabolic reactions convert polymers into monomers…
A: Metabolism encompasses all life-sustaining chemical reactions in organisms.Metabolism involves two…
Q: Which of the following molecules shown are the reduced products produced in the citric acid cycle…
A: The citric acid cycle, otherwise called the Krebs cycle or tricarboxylic acid (TCA) cycle, is a…
Q: Draw the Haworth projection of B-L-altrose. You will find helpful information in the ALEKS Data…
A: Haworth projection
Q: create a table to summarize the ATP count for the listed carbohydrates below that will undergo…
A: The difference between the aerobic breakdown of sugars in liver, kidney & heart v/s muscle &…
Q: Identify which of the statements below is/are true regarding the "kinase" family of enzymes.…
A: Enzymes are the proteins that speed up chemical reactions in the biological system. Substrates are…
Q: We did an experiment about carbohydrate chemistry and the prof did not elaborate on the details. She…
A: Moore's test is used to detect the presence of reducing carbohydrates. Here, the sample is treated…
Q: A peptidyl-tRNA in the P site has a strange modification with an ether versus an ester bond to the…
A: Answer :- The scenario with peptidyl-tRNA in the P site—a part of the ribosome involved in protein…
Q: Nigerose is a disaccharide that consists of two glucose units linked by an a(1-3) bond. Use the…
A: Two-dimensional representations of the cyclic structure of monosaccharides are called Haworth…
Q: Protein X binds to molecule A. When [A] = 24.5 µmol L-1 at equilibrium, half of X is bound to A and…
A: Protein X binds to molecule A. When [A] = 24.5 µmol L-1 at equilibrium, half of X is bound to A and…
Q: Consider the mechanism of enolase, as indicated below. Which of the following correctly describes…
A: Before going into the solution, we should know what general base and general acid species are in…
Q: Which of the following is the a-anomer? H но H Но H2C H ОН H2C- нн ОН со 4 1 2 1 Submit 3 -OH Н ОН…
A: Alpha anomer
Q: Which of the processes are coupled to the dephosphorylation of ATP? membrane transport that…
A: The structure of ATP comprises of a nucleoside triphosphate, consisting of a nitrogenous base…
Q: Which monosaccharide is known as blood sugar in the body? glucose galactose fructose
A: Monosaccharide is a simple sugar consisting only of one unit ("mono" means one). They serve as…
Q: Describe in one page why hydrogen, carbon, nitrogen, and oxygen can be considered the most important…
A: A living cell is the basic unit of life. It is capable of independent existence (as is the case of…
Q: 3. Assuming that there are 5 x 1013 cells in the human body and that ATP is turning over at a rate…
A: We have to find out how many watts the human body consuming.
Q: All of the following statements about the B-oxidation pathway are true except: The pathway is…
A: In metabolism, β-oxidation is the catabolic process by which fatty acid molecules are broken down.…
Q: A 25-year-old man has a lifelong hemorrhagic diathesis. The PT and bleeding time are normal, but the…
A: Hemorrhagic diathesis is a condition characterized by a tendency to bleed excessively or for an…
Q: Glyceraldehyde 3-phosphate is an intermediate of glycolysis. This molecule was also generated during…
A: During glycolysis, glucose is broken down into two molecules of pyruvate and producing energy in the…
Q: The concentrations of ATP, ADP, and P; differ with cell type. Consequently, the release of free…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: Answer the following using the structure: a. Is this a purine or pyrimidine? b. Is this a…
A: Deoxyribose and ribose are aldopentoses which after phosphorylation form deoxyribonucleotide and…
Q: Choose Two. The Ramachandran plot indicates: B Ca E ||||||| C1 H H A Combined preference for a about…
A: Amino acids are the building blocks of protein. There are 20 standard naturally occuring amino acids…
Q: The C-2 epimer of A is [Select] [Select] H- Н- НО Н- -H CHO OH OH Н H OH НО НО OH -H -H Н- Н- CHO B…
A: Carbohydrates are polyhydroxy aldehydes or ketones. Monosaccharides are simplest carbohydrates:…
Q: As a result of rotation about six of its bonds, DNA can exist in a variety of forms. Determine…
A: There are 3 major DNA variants. They are A-DNA, B-DNA and Z-DNA. In all these variants, A pairs…
Q: What type of IPF would you expect from the following R groups in a tertiary structure of a protein?…
A: The proteins are composed of twenty naturally occurring amino acids connected via peptide…
Q: Which of the following lipids would you expect to find as a structural component in a membrane, and…
A: Phospholipids are a class of lipids that are essential components of cell membranes in all living…
Q: The graph below shows the hemoglobin dissociation curves (also called equilibrium curves) for normal…
A: Bohr effect tells us that the binding of protons (H+) to hemoglobin (Hb), decreases Hb's affinity…
Q: H OH OH HO OH HO- two disaccharides H two monosaccharides and one disaccharide four monosaccharides…
A: Beta galactosidase is an enzyme which cleaves the beta glycosidic bond between galactose and…
Q: Discuss the major challenges when using microarray techniques to study differential gene expression.…
A: Microarray is a powerful laboratory technique used in genomics and molecular biology to…
Q: 1. Cyanide, oligomycin, and 2,4-dinitrophenol are all inhibitors of oxidative phosphorylation in…
A: ETC consists of four protein complexes called Complex I, II, III and IV that transport electrons…
Q: 25.4 Would you expect to find the highest concentration of each of the following in raw domestic…
A: Would you expect to find the highest concentration of each of the following in raw domestic…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 2 images
- Draw the complete structure of uridine 5′-phosphate, one of the four major ribonucleotides.A genetics student was asked to draw the chemical structureof an adenine- and thymine-containing dinucleotide derivedfrom DNA. His answer is shown below. The student made morethan six major errors. One of them is circled, numbered 1, andexplained. Find five others. Circle them, number them 2 to 6, andbriefly explain each by following the attached given.What is the isoelectric point of this fragment? DHVTHLRKMG
- Please ASAP. Thank you. Regarding the double helix of DNA, which of the following is true? a. Guanine pairs up with cytosine with three hydrogen bonds b. Complementary strands of DNA are held together by covalent bonds c. The backbone consists of ribose sugars H-bonded to phosphate groups d. Uracil pairs up with adenine with two hydrogen bonds1. Draw the structure of the polyribonucleotide UAGCCUG. 2. Draw the structure of the polydeoxyribonucleotide CGTAGAT.Draw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this dinucleotide.
- The goal of structural proteomics project isa) To crystallize and determine the structure of as many proteins as possible, in many cases with little or no existing information about protein functionb) To identify and sequence of all the genes present in the human bodyc) To introduce new genes to human beingsd) To remove disease causing genes from humansDraw the structure of the nucleotide represented by dTMP.From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.