A peptidyl-tRNA in the P site has a strange modification with an ether versus an ester bond to the tRNA. When it is in the P site undergoing catalysis in the otherwise normal way, this molecule will become: More susceptible to the nucleophilic attack A better nucleophile Less susceptible to the nucleophilic attack A worse nucleophile
Q: Case Study: Enzyme Kinetics Data for new statin drug (inhibits HMG CoA reductase): 1 Substrate (UM)…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Which of the following is an important enzyme involved in the synthesis of cholesterol from isoprene…
A: Acetyl-CoA Formation: Cholesterol synthesis begins with the conversion of acetyl-CoA, a two-carbon…
Q: A membrane simulator is shown below. Watch the video clip in order to answer the question. Diffusion…
A: Osmosis is the movement of water molecules across a semipermeable membrane, driven by the difference…
Q: Proline racemase catalyzes the conversion between L-proline and D-proline. The Km and kcat for this…
A: Proline racemase is an enzyme that catalyzes the racemization of L-proline (S configuration) to…
Q: ANSWER THE FOLLOWING PROBLEM AND EXPLAIN YOUR ANSWER FOR BETTER UNDERSTANDING. No. 3. Which Amino…
A: There are four classes of biological macromolecules; proteins, nucleic acid, lipids and…
Q: Which of the equations below best represents how excess acid in the blood plasma can be removed in…
A: All biological processes are pH dependent. Even a slight change in pH can result in a large change…
Q: Which of the following statements is WRONG with regard to the following molecule? HO 0² N OH NH₂ N…
A: The given compound is cAMP. Cyclic adenosine monophosphate is a second messenger, which is important…
Q: Congratulations! Due to your success in Dr. Daniel's Cellular Metabolism class. You have been…
A: A reaction is said to be an oxidation reaction if it remove electrons. In other words, the oxidation…
Q: The second messenger cyclic AMP (CAMP) is synthesized from ATP by the activity of the enzyme…
A: Some signalling molecules cannot diffuse across the biological membranes so they communicate their…
Q: Fructose is a labeled on its anomeric carbon with 14C. This labeled fructose is added to muscle…
A: A method utilized in many scientific investigations including radiocarbon dating is carbon-14 (C-14)…
Q: 3. Aspartate aminotransferase (AspAT) catalyzes the following reaction: COO™ C=O CH₂ COO…
A: Km is sometimes thoughtlessly used as an indicator of affinity of an enzyme for its substrate. But,…
Q: Synthesis of the activated form of acetate (acetyl-CoA) is carried out in an ATP-dependent process.…
A: The nucleotide coenzyme adenosine triphosphate (ATP) is the most important form of chemical energy…
Q: Case Study: Enzyme Kinetics Data for new statin drug (inhibits HMG CoA reductase): I Substrate (UM)…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: What changes would you see in plasma (blood) acidity?
A: pH is the power of hydrogen ions. It is defined as the negative logarithm of hydrogen ion…
Q: What type of DNA damage would you expect from UV-B irradiation (at 260 nm) of DNA that includes the…
A: UV-B radiation (260 nm) is one of the well characterized mutagens which causes a specific type of…
Q: Which type of motifs/folds are found in the protein shown below O Colled-coil O EF Hand O Horseshoe…
A: The final products of the expression, "the proteins" attain higher folding confirmation of…
Q: Consider a peptide AKCVSEAALRIKQEANSL. Which of the following secondary structures the peptide can…
A: In the light of proteins, secondary structure refers to the regional spatial organization of the…
Q: A) Effect of Enzymes on Reactions Which of the following effects (a-g) would increase the rate of an…
A: We know Keq is the equilibrium constant and it is equal to .Here;[P] is the concentration of product…
Q: Biological membranes are selectively permeable, allowing certain molecules to cross the membrane,…
A: The cells or the plasma membrane is the outermost layer enclosing the cell. It is responsible for…
Q: CO₂ + H₂O H₂CO3→→→→→ H+ + HCO3
A: pH is called as power of hydrogen. Basically, it is the negative logarithm of hydrogen ion…
Q: Glucose generally exists in ring (cyclic) form. A Haworth projection shows the orientations of the…
A: Glucose is a monosaccharide and classified as an aldohexose since it contain 6 carbon atoms along…
Q: 3. Relation between Reaction Velocity and Substrate Concentration: Michaelis-Menten Equation (a) At…
A: The initial rate of an enzyme-catalyzed reaction is defined by the Michaelis-Menten equation as a…
Q: Which of these amino acids is NOT a common attachment point for sugars in glycoproteins? A) Gly…
A: The proteins that contain the covalently attached oligosaccharide chains to the amino acid residues…
Q: Imagine you are able to incorporate a heavy isotope into the atoms of both strands of double…
A: Replication is a process wherein a daughter strand is synthesized using the parent's DNA strand. One…
Q: yruvate carboxylase catalyzes the first step of gluconeogenesis. ATP + HCO3─ + pyruvate →…
A: Actual free energy change is related to standard free energy change by the following mathematical…
Q: Explain the role of transistors in microchip functionality
A: Microchips are tiny electronic devices containing a variety of integrated circuits. They are…
Q: +H₂N-CH-COO™ 1 CH₂ I CH₂ I CH₂ I +H₂N-CH₂ A. amino acid D O amino acid B amino acid C O amino acid A…
A: Amino acids are biomolecules that have a hydrogen atom, an amino group and a carboxyl group linked…
Q: The monosaccharides shown below are H но-н H- OH \\ HOH но-н но-н H-OH HO H H-OH CH₂OH Enantiomers…
A: Isomers are defined as the two or more molecules with the same molecular formula but different…
Q: What is the minimal resolution required for gleaning insights into structures of drug-drug target…
A: The minimal resolution required for gleaning insights into the structures of drug-drug target…
Q: HO-CH2 НО ОН H 0 Н но-сн, Н ОН H ОН Н Н ОН но-CH2 Н Н Н OH Н H OH HO-CH, H ОН H о он ОН H List the…
A: Monosaccharides are connected by glycosidic bonds. Glycosidic bonds are covalent bonds, formed when…
Q: A polypeptide is cleaved into peptides by treatment with trypsin and cyanogen bromide, and then the…
A: Trypsin cleaves specifically peptide bonds at the C-terminal side of lysine (K) and arginine (R)…
Q: iven the kinetics data for each enzyme in the presence and absence of its inhibitor, determine the…
A: A competitive inhibitor competes with the substrate for active site of an enzyme. If inhibitor…
Q: what are the non-regulatory enzymes involved in glycolysis.
A: Glycolysis is the 10-step enzymatic oxidation of a single glucose molecule into two molecules of…
Q: Complete the Haworth projection of B-D-fructose. The anomeric carbon is shown. C H Answer Bank OH…
A:
Q: Which monosaccharide is known as blood sugar in the body? glucose galactose fructose
A: Monosaccharide is a simple sugar consisting only of one unit ("mono" means one). They serve as…
Q: There is another melanocyte-stimulating hormone called B-melanotropin. Cleavage of 3-melanotropin…
A: We have find out the sequence of amino acids
Q: Which of the following is the most efficient enzyme An enzyme with a high kcat and a high Km. An…
A: Enzymes play a fundamental role in biological processes by catalyzing chemical reactions, thereby…
Q: How are oxytocin and vasopressin related?!. They are synthesized in the hypothalamus.II. They have 8…
A: Oxytocin is a neuropeptid. that is released by the posterior pitutary gland. This hormone has been…
Q: Single stranded DNA.
A: DNA:Its full form is deoxyribonucleic acid.It carries genetic instructions for the development,…
Q: Draw a representation of an allosteric binding site of an enzyme. The allosteric site must bind an…
A:
Q: Which of the following statements regarding DNA is false? Features a beta glycosidic bond between…
A: DNA or deoxyribonucleic acid is a genetic material that transfers genetic information from one…
Q: The sigmoidal, cooperative binding curve commonly observed for hemoglobin is a result of: a)…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: 2. Mitochondria isolated from bovine cardiac muscle, when subjected to sonication, form closed mem-…
A: The electron transport chain contains four complexes: Complex I, II, III and IV. Electrons are…
Q: Suppose you discover a new bacterium that has a concentration of 15 nM Cu2+ inside the cell, and 1…
A: Diffusion is the movement of silute particles or molecules from the region of higher concentration…
Q: Which of the following might be a feature(s) of a lipid that has been converted from a fully…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbons to 36 carbons.…
Q: 1) The approximate length of a DNA double helix is around 0.34nm per base pair. If the extracted D…
A: 1) A somatic human cell has 23 pairs of chromosomes, that is 46 pieces of DNA. The combined length…
Q: ANSWER THE FOLLOWING PROBLEM, ILLUSTRATE YOUR WORK AND EXPLAIN YOUR ANSWER FOR BETTER UNDERSTANDING.…
A: There are four classes of biological macromolecule: proteins, nucleic acid, carbohydrates and…
Q: 10. Calculating AG in a Rat Liver Cell Calculate the free energy of hydrolysis of ATP in a rat liver…
A: Gibbs free energy is the energy which is available to do useful work. The change in Gibbs free…
Q: What is the most likely consequence of a single base mismatch error made by RNA polymerase? A…
A: The central dogma of molecular biology is a theory, according to which, genetic information flows…
Q: calculating the “Activity ([PNPP]) for each Supernatent.
A: Here we are undertaking the acid phosphatase assay. Acid phosphatase enzyme catalyzes the hydrolysis…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Which of the following would be a good chemotherapy approach: blocking formationof the ribonucleotide GTP or blocking formation of the deoxyribonucleotide dGTP?Why? Please explain the chemical differences between each of the two nucleotides. Use the specific processes below to support your choice by explaining how either GTP or dGTPare related to these and how loss of the particular molecule would affect each process. *PEP carboxykinase in gluconeogenesis*Succinyl-CoA synthetase in the TCA Cycle*Glucagon signal transductionMatch the following antibiotics with the drug strategy that would provide resistance to them. rifampin which blocks transcription [ Choose ] Choose] tetracycline which misaligns the beta-lactamase anticodon to its codon mutation of the TRNA binding site of the ribosome penicillin which blocks peptidoglycan creation of alternate metabolic pathway that ultimately leads to the same product synthesis mutation of RNA polymerase polymyxin which causes leakage in the porin which removes drug from periplasmic space cell membrane sulfonamide which inhibits enzyme of [Choose ] folic acid synthesis pathway Question 14 2 pts % & 5 7Which statement is true for the active site residues of RNase A, lysozyme, or trypsin? Select any/all answers that apply. O A. His12 (RNase A) initially acts as an acid. O B. His119 (RNase A) initially acts as an acid. O C. Glu35 (lysozyme) initially acts as an acid. O D. His57 (trypsin) initially acts as an acid. O E. Ser195 (trypsin) initially acts as an acid.
- Given the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro inThe following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′After the polypeptide chain is passed to the next amino acid the uncharged tRNA leaves through this site A site E site P site
- The synthesis of a protein requires that the amino acids that constitute the growing polypeptide chain be covalently linked to the amino acid attached to the tRNA at the aminoacyl site of the ribosome. Which of the following catalyses this reaction? Options: the aminoacyl tRNA synthetase eEF2 eEF1-GTP a large ribosomal RNA the initiator tRNA metUsing threonyl-tRNA synthetase as an example, account for the specificity of threonyl-tRNA formation.Why do aminoacyl-tRNA synthetases need ATP? to prevent the 2'OH from being aminoacylated to provide energy to drive the reaction to add the 3' adenosine onto the tRNA to add a leaving group on the amino acid
- Which of the following cannot be said regarding aminoacyl tRNA synthetase? It is essential for the correct reading of codons. A single tRNA synthetase can attach different amino acids to their corresponding tRNA. It is first activated when it catalyzes a reaction between ATP and an amino acid to form an aminoacyladenylic acid (amino acyl-AMP). It is responsible for the attachment of the correct amino acid to the correct tRNA. There is a different tRNA synthetase for each amino acid that will be attached to a tRNA.E. coli ribonuclease H1 is an enzyme that catalyzes the hydrolysis of phosphodiester bonds in RNA. Its proposed mechanism involves a 'carboxylate relay,' as shown below. His124 Asp70 || -HN-CH-C -HN-CH-C- CH2 CH2 c=0 RNA substrate HN H. H. (1) Fill the blanks. In the reaction scheme above, His124 acts as a ( ). The purpose of this relay system is to deprotonate the water molecule (II) so that it becomes a better ( :0TRNAS are 'charged' or activated by aminoacyl TRNA synthetases. Select the correct statements regarding this process. The process is dependent on interactions between ribosomes and aminoacyl TRNA synthetases. The aminoacid is added to the D-loop of the tRNA. Aminoacyl TRNA synthetases are pre-associated with tRNAS. The amino acid is attached to the terminal to the 3' hydroxyl of an adenine in the acceptor arm. The process requires an aminoacyl-adenylate intermadiate. QUESTION 19 Select the correct statements regarding myosin-mediated contraction the sarcomere. O Ca2+ is required for the binding of myosin to f-actin. Myosin and f-actin are randomly distributed in the sarcomere. Physical pulling of the actin microfilament requires three distinct conformation changes on myosin that involve ATP binding, ATP hydrolysis and sequential release of inorganic phosphate and ADP. Myosin-mediated contracted is ubiquitous across all cell types. O O O O