Post lab questions1) The approximate length of a DNA double helix is around 0.34nm per base pair. If the extracted DNAwas in the form of a single double helix, calculate how long it would be in meters. (1nm = = 10-⁹m)Clear All Formatting2) How long would it be in miles? (1mile = 1609.34m)3) Is your double helix longer than the diameter of the Earth?4) Is your double helix longer than the circumference of the Earth?

1) A somatic human cell has 23 pairs of chromosomes, that is 46 pieces of DNA. The combined length…

Answered: 1) The approximate length of a DNA…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

DNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?
12:26 AM E G M 46 l i72% SCIG10_ACTIVITYSHEET_Q3W4.pdf Let's Evaluate: A. Multiple Choice: Encircle the letter of your chosen answer. For numbers 1-3 refer to the statement: The following is the base sequence on one strand of a DNA molecule: AAT GCC AGT GGT 1. If this strand is replicated, which of the following is the complementary strand that is produced? A. TCG TCC GTC TAG C. TTA CGG TCA CCA B. AGC AGG CAG GGT D. UCG UCC UCU AGA 2. If transcribed into an mRNA, what would be the resulting strand? A. UUA CGG UCA CCA C. AGC AGG CAG AUC B. AGC AGG AGA T C D. TCG TCC GTC TAG 3. During translation, the tRNA sequence of nucleotides arranged linearly is A. TCG TCC GTC TAG C. AGC AGG CAG AUC B. AAU GCC AGU GGU D. UCG UCC GỤC UAG 4. How many codons are needed to specify three amino acids? В. 6 А. 3 С. 9 D. 12 5. Some events that take place during the synthesis of a specific protein are listed below. I. Messenger RNA attaches to a ribosome. II. DNA serves as a template for RNA production. III.…
The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your answers, show how you came up to each result?(a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in micrometer?
Questions are talking about amplification of DNA When we run the gel, we also run a ladder why? what information does that give us. why does it form a ladder shape on the gel (what is happening to cause things to separate out in many bands)?
Q.)The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in mm?
Estimate the viscosith of 1.0 vol % agarose gel solution if it took 58 minutes for 1500 base pairs long DNA molecule to migrate 11cm during gel electrophoresis under 110V. Assume appropriate numerical values for the missing parameters such as the charge and diameter of DNA molecules.
To answer the prompts below, draw on a piece of paper or your tablet the chemical structure of the trinucleotide 5' - TCA 3', labeling the 5' and 3' ends. Opposite this structure, - draw the complementary trinucleotide to make a double- stranded DNA molecule. A. What is the complementary trinucleotide sequence from 5' to 3' (enter answer as nucleotides only with no spaces)? B. How many non-covalent hydrogen bonds stabilize this double-stranded DNA structure? C. How many covalent phosphate linkages stabilize this double-stranded DNA structure?
Show the separation pattern of the following DNA molecules on 1 % agarose gel. Justify your results. 5 kbp 5 kbp 5 kbp 5 kb +
To answer the prompts below, you will need to draw the chemical structure of the trinucleotide 5' - ACG - 3', labeling the 5' and 3' ends. Opposite this structure, draw the complementary trinucleotide to make a double-stranded DNA molecule. A. What is the complementary trinucleotide sequence from 5' to 3' (enter answer as e.g. CGA)? TCG B. How many non-covalent hydrogen bonds stabilize this structure? 8 C. How many covalent phosphate linkages stabilize this structure? 10 D. Which type of bond takes less energy to break? Phosphate linkage O Non-covalent hydrogen bonds
11:41 Thymine Adenine 3 end Practice Problems Write the complementary strand for A-C-C-T-G-A-C-T-G Write the complementary strand for C-G-G-G-C-A-T-T-A of rna SlidePlae Problems Visit DNA Deoxyribonucleic acid. DNA labeled complemen- structure DNA is a nucleic acid ... mplementary strand tary strand of dna C-G-G-G-C Images may be subject to copyright. Learn More TT-A dna replication Related images DNA Deoxyribonucleic acid. DNA . slideplayer.com What is the complementary strand Seeof DNA? > Practice Question •ATTCCG If the template of a strand of DNA is 5'AGATGCATC", the complementary strand 5CGGCATTA3 will be A TCTACGTAG B. CTACGTAGA C AGATGCATC D." AGACGTCTA ANSWER: TAAGGC A AA AQ A,T,C,G complementary stran
Question: DNA molecules are compressed by integrating with non-nucleic acids. What property of these DNA binding molecules make them most attracted to DNA-A) High PolarityB) Nonpolar BackbonesC) Large SizesD) Positive Charge Answer?
5) Answers to the following questions. A. You are given a tube containing 275 ng of purified PCR product (DNA) that is 1262 bp long. How many picomoles of PCR product are in the tube? The average weight of a deoxynucleotide monophosphate is 328 g/mol. B. You digest a 5 kb plasmid with two enzymes that yield fragments of 4 kb and 1 kb, and resolve the digest on the gel. What would you predict to see in terms of the intensities of the bands?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS