Around Wisconsin we see six types of prairie communities (Short grass, Mesic tall grass etc.). This is an example of what type of biodiversity? O Functional Diversity O Ecosystem Diversity O Genetic Diversity O Species Diversity
Q: A. In the above diagram, which part of the ATP molecule contains energy. B. Why does ATP contain…
A: ATP or Adenosine Triphosphate is the chemical energy molecule that provides energy to chemical…
Q: Which of the following accurately describes the inducibility of adaptive immunity? A) a given…
A: Answer : the inducibility of adaptive immunity are : A) a given immune response acts against a…
Q: Briefly outline the aetiology and pathophysiology of Coeliac disease
A: There are a few important points : Prolamins: Proteins in food responsible for immune reaction and…
Q: What are the unique features of Henle loops that contribute to countercurrent multiplication during…
A: The gradient of increasing hyperosmolality of medullary interstitium is maintained by a peculiar…
Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…
A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…
Q: A patient who is homozygous for familial hypercholesterolemia (FH) will: OA) have only one defective…
A: Introduction: A chromosomal 19 abnormality causes familial hypercholesterolemia. Familial…
Q: explain the concept of signal transduction pathway and give one example in detail of a signal…
A: Introduction:- Signal transduction is the process in which a signal molecule binds to their specific…
Q: Propose a protocol (~100 words) to study the efficacy of the antibody in this mouse model.
A: According to the given data, factor 801A is transduction molecule essential for growth of ovarian…
Q: place the following in the correct order for sperm movement 4 5 6 1 2 3 penile urethra epididymis…
A: INTRODUCTION Sperm Male reproductive gamete helps in sexual reproduction. Process of synthesis of…
Q: Which of the following is NOT an example of a spontaneous mutation? A) errors in replication of DNA…
A: Random mistakes caused by DNA polymerase during DNA replication cause spontaneous mutations to…
Q: T-cell receptor diversity is controlled by O a. O b. C. O d. e. DNA recombination during mitosis in…
A: ANSWER) T cell receptors are the protein molecules preserver the surface of T cells which are…
Q: Biofilms represent an important environmental niche. A) How does growth on a surface differ from…
A: Biofilm is a thin, slimy layer of bacteria that forms on surfaces. It is composed of extracellular…
Q: Use the information below to answer the question Cell A = 1 μm x 1 μm x 1 μm Cell B=2 μm x 2 μm x 2…
A: The surface area-to-volume ratio is a measure of how much surface area a cell has relative to its…
Q: Your kidneys are responsible for regulating water levels in the body. Given what yo know about…
A: Kidneys are organs responsible for the removal of waste and toxins. The excess water from the…
Q: Pictured below is a food web. Each letter is a species. In order to observe top-down control, which…
A: An important characteristic of an ecosystem is the populations of various species in each trophic…
Q: Use the Information below to answer the question. Compound A B с Binds to receptor Yes Yes No…
A: Signal transduction is described as a process through which molecular signals are transmitted from…
Q: You generate action potentials in a neuron bathed in solution in a petri dish by applying a…
A: An action potential is a rapid sequence of changes in the voltage across a membrane. This action…
Q: CD4 cells are cells and CD8 cells are cells A killer, suppressor B helper, cytotoxic C cytotoxic,…
A: Introduction: Our immune system's lymphocytes are a subset of white blood cells. There are two of…
Q: A scientist wants to make a random mutation in a specific gene to investigate that gene's function.…
A: A random mutation is a change in the sequence of nucleotides that makes up an organism's genetic…
Q: ) Two islands with similar topologies have the same size and same distance from the mainland. One…
A: Two islands with similar topology mean they have connected in the same way.vicariance means…
Q: Which of the following is not a weight-category sport? Group of answer choices judo wrestling boxing…
A: Weight categories are used in variety of sports like boxing, mixed martial arts like judo, kick…
Q: diversity is the total number of species occurring in a region.
A: All theories on species are predicated on the idea that a species can be distinguished from other…
Q: QUESTION 13 Which of the following is NOT true about the function of vacuoles? O a. Storage of waste…
A: The cell has been divided into cell organelles. Division of labor is also visible at the organelle…
Q: QUESTION 39 Which of the following statements describes the relationship between photosynthesis and…
A: Photosynthesis is an anabolic process that uses light, water, and carbon dioxide to synthesize sugar…
Q: Which of the following is an effect of pollution on nutrient cycling of polluted ecosystems? O a.…
A: One of the most common pollution on nutrient cycling of polluted ecosystems is the process of…
Q: Which of the following statement regarding enzymes is false?
A: The majority of vital biological processes are based on how enzymes work. The linear amino acid…
Q: Which of the following would be considered optimal to maximize muscle hypertrophy? Group of…
A: Introduction High protein intakes facilitate preserve lean mass in dieters, particularly lean…
Q: Ch. 5: Acute Respiratory Failure (ARF) can arise from all of the following a) spinal cord injury b)…
A: Acute respiratory failure is a sudden inability of the lungs to adequately exchange oxygen for…
Q: Glycogen stored in muscle and liver is used for following organs in the order: Select one: a.blood,…
A: Note: please always mention the needed parts in case of multiple questions. Thank you! Enzymes are…
Q: QUESTION 17 When changing overload, which is the prudent decision? OA. for unfit individuals, change…
A: 17) Overload refers to the concept of gradually increasing the demands placed on the body during…
Q: Which of the following statements regarding retroviruses is FALSE? A) a cellular enzyme converts…
A: Normally virus can have genetic material as either RNA or DNA. Retrovirus is a type of virus which…
Q: Use the following data to calculate the original bacterial sample. 1 ml Sample of E. coli 1/10 OF-10…
A: Bacteria is a ubiquitous microscopic prokaryotic organisms which does not contain true nucleus and…
Q: Around 8,000 years ago wild potato's were being harvested by humans in South America. They were from…
A: Natural selection is the selection process through which the population of living organisms adapt to…
Q: Why is there many different glucose transporter for the human body? in our biochem book we have 12…
A: The most basic type of carbohydrate is glucose. Through the process of photosynthesis, plants make…
Q: QUESTION 48 In facilitated diffusion, the diffusion rate of a specific molecule across a membrane…
A: Due to the carrier's role, assisted diffusion normally moves along more quickly than simple…
Q: Which of the following is false? Every cell in the body makes every protein. Each cell contains an…
A: Introduction: All cells' primary operating molecules and structural constituents are proteins. All…
Q: Which of the following would BEST help conserve biodiversity. CHOOSE ONLY ONE a. Plant native trees…
A: Biodiversity Conservation refers to upliftment, management and protection of biodiversity for…
Q: Long-wave solar radiation is more energetic than short-wave solar radiation. True
A: There are two types of radiation depending on the wavelength. Long wave solar radiation: These waves…
Q: The compound glucose 6-phosphate is NOT encountered in which of the following processes? conversion…
A: Glucose 6-phosphate is an important intermediate in the metabolism of glucose. It is formed from…
Q: The concentration of concentration of Na+ and Cl-; K+ O Cl-Na+ and K+ OK+ and Cl- Na+ OK+: Na+ and…
A: A cell is the basic unit of life. All living organisms are made up of cells, which are microscopic…
Q: In addition to pyruvate dehydrogenase, which of the following enzymes is also a regulatory site in…
A: Cellular respiration is a metabolic process in which glucose molecule is broken down and eventually…
Q: What pathway does sound follow through the ear? O pinna; ossicles; oval window; tympanic membrane;…
A: Ear is the sensory organ which conducts sound waves from external environment into the inner ear and…
Q: Investigators interested in understanding the relationship between mammography and breast…
A: Research design is a way of planning that instructs how the research will be going to conduct. Based…
Q: Which of the following takes place in the mitochondria (including the matrix inner and outer…
A: Mitochondria are commonly referred to as the "Powerhouse of the Cell." They are double…
Q: Your friend is intrigued by Cdks and purifies Cdk from the daisy plant. She is able to determine the…
A: Protein-protein interactions frequently include conserved amino acid sequences. Here we need to find…
Q: Why do we observe PdO/PdOx particles via HAADF-STEM but not via SEM?
A: PdO/PdOx particles are nanoparticles composed of palladium (Pd) and oxygen (O) atoms. These…
Q: Glomerular filtration rate is controlled by: 1. autoregulation mechanisms, including…
A: The process of generating urine begins with glomerular filtration. The kidneys utilize this…
Q: Keratin is a type of found in the cytosol, which means its hydrophobic amino acids are Select one:…
A: Keratin is a type of protein that is also known as scleroprotein. This protein is present in hairs.…
Q: Ch. 7: All of the following may lead to chronic kidney disease EXCEPT: a) renal artery stenosis b)…
A: To prevent a stone recurrence, guidelines advise increasing water consumption to produce a urine…
Q: The cone photoreceptors are used for O color; fovea centralis O black and white; fovea centralis…
A: Photoreceptors are specialized neurons found in the retina that convert light into electrical…
Step by step
Solved in 2 steps
- Which of the following best describes the trend of biodiversity on the Earth's surface? * O It decreases towards the equator It increases towards the equator O It remains the same throughout the planet O It is not affected by the change in latitude Which is NOTa characteristic of a biodiversity hotspot? * O High species biodiversity High urban development O High endemic species population O High susceptibility to habitat destructionWhy do you think Costa Rica (Core Case Study) hasset aside a much larger percentage of its land for biodiversity conservation than the United States has?Should the United States reserve more of its land forthis purpose? ExplainIf you wanted to protect diverse species in coastal marsh, you should identify the right habitat by fınding -- a bed of grass underwater but near the shore an area of land that is periodically covered by saltwater a deep, fast-moving river a flat, grassy area that is elevated above sea level so that it stays dry except during floods an area with dense mangroves
- To protect provided by biodiversity, it is important to take steps like setting aside land as Costa Rica has done. new construction developments lifestyle changes technological growth ecosystem services O agricultural accessIn which of these areas would one expect to find communities with the highest biodiversity? An area that has recently been subjected to a volcanic eruption. An area with low precipitation and seasonal temperature changes. O An area that is warm year-round and has relatively high precipitation. An area high in the mountains that is covered by snow eight months of the year.A rain forest habitat is located in an equatorial area with a warm, wet climate. Nearby is a savanna, where the climate is equally warm but much drier. Species diversity is much higher in the rain forest. Which rain forest habitat characteristic most likely explains this difference? O More disturbances, leading to rapid species turnover O More complex habitat structure, enabling greater food availability O More complex habitat structure, enabling greater niche specialization O Fewer disturbances, leading to rapid population growth of a few species O Fewer open spaces, leading to inability of organisms to leave the habitat
- Evolution of Biodiversity Part B Chrome Remote Desktop Types oI DIOUuiversity Genetic diversity is important for evolution and adaptation. O True O FalseBiodiversity: Values & Threats 1. In terms of the number of species in various taxonomic groups, what types of organisms represent thegreatest diversity on our planet? And how do we know we’re not “done” cataloging all of life on earth? 2. When scientists try to estimate the number of species that actually exist on earth today, why is thefigure so variable? 3. Describe the global biodiversity patterns found in relation these parameters:Latitude Precipitation Elevation 4. In a well-crafted paragraph (5-7 descriptive sentences) specifically describe 4 key ways thatbiodiversity benefits mankind. Use examples to support each of your statements.Aphids are insects that feed on tomato plants. If you want to save your tomato plants from the aphids, get ladybugs becaus Which species would have the HIGHEST total biomass in this community? O Aphids O Ladybugs O Tomato plants
- Biodiversity is described as: The seasonal and daily changes in an environment The range of different species in an environment The influence of physical factors on an environment The way species differ from one anotherHow would you reconcile the emerging needs of human beings regarding their health and the need to protect the biodiversity? Do you think that Earth can exist without human beings taking care of it? Or biodiversity also needs human beings for it to ba a continuous growing process?How does the biodiversity of an ecosystem change over time as it progresses through the natural stages of succession? O biodiversity decreases O biodiversity does not change biodiversity increases