About the role of coated proteins in the vesicle budding and the molecules that are likely to be either included or excluded from the vesicles that are newly formed. Also about the best example of the protein that is involved in the vesicles pinch off.

Q: Define about Cloning Vectors ?

A: A cloning vector is a small piece of DNA that accepts the target DNA and multiple its copies manifol...

Q: Human somatic cells have 46 chromosomes. Are the cells different in any way from the parent cell and...

A:

Q: Assign a genotype to each individual in generation II. 1 2 3 II 4 7 8 II 9 10 11 12 IV 13 Griffths, ...

A: Introduction: Human males carry single copy of X-chromosome and hence allow the expression of recess...

Q: In Figure 7-23(a), label all the leading and laggingstrands.

A: Introduction  DNA replication is very crucial for the continuation of life as every new daughter cel...

Q: 1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5' GAGCCAUG...

A: Gene is a hereditary units that are involved in sending hereditary instructions from parents to offs...

Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical pro...

A: ANSWER;-  Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content = 56...

Q: . In corn, three dominant alleles, called A, C, and R,must be present to produce colored seeds. Geno...

A: The term genotype is associated with the genes present in an individual. The expression of genotypes...

Q: the treatment that utilizes transgenic organisms to mass-produce proteins O stem cell therapy O gene...

A: Recombinant DNA technology plays a major role in modifying the genetic setup of an organism to have ...

Q: Provide 3 factors that influence sea level rise. Explain how each factor is influenced over differen...

A: Mostly human-induced global warming is the force behind the current global sea-level rise.

Q: For each species, all______ in the complete set of chromosomes is the____ . a. genomes; library c. m...

A: Chromosomes are the thread-like structures that appear during cell division.  

Q: In roses, the synthesis of red pigment is produced by two steps in a pathway. gene O magenta interme...

A: Null mutation :- This mutation is type of loss of function mutation, in this mutation the product ma...

Q: Melting of _____ does not contribute to sea level rise   a. Greeland ice sheet   b. Antarctic ic...

A: Melting of ice leads to the increase in sea level. When the temperature increases, polar caps melt. ...

Q: _1. It is the important organ that controls thought, memory, emotion, touch, motor skills, vision, b...

A:

Q: 1. Read the paragraphs below. For each paragraph, write the letter of the diagram from the diagram s...

A:

Q: The optimal volume for blood-culture collection on adults is

A: d. dependent upon the patient's body weight

Q: Seven to nine testes in rows: * which is the following the crrect schistosomes     Schistosoma manso...

A: Schistosoma mansoni is a water borne blood parasite which belongs to the group of blood flukes gener...

Q: 1. -penia - 2. -dilation - 6. -sclerosis - 3. -graphy - 4. -megaly - 5. -plasty - 7. -stenosis - 8. ...

A: Note - we are supposed to answer three subpart of a question. Please repost other questions separate...

Q: GIVE THE EMBRYOLOGICAL EXPLANATION FOR  "The dorsal mesocardium is a ventral mesentery." please be ...

A: 1 : a ventral mesentery of the undeveloped stomach that endures as the falciform tendon and the less...

Q: A) What is extinction? How extinction is different from expiration? Explain. (B)List the ive mass ex...

A: Evolution is a slow but continuous process. 

Q: After conducting the Gram staining procedures and you observe nothing (you didn’t see anything) in y...

A: Introduction Gram staining, commonly known as Gram's method, is a staining technique that is used to...

Q: Research have stated that there are factors that could affect the efficacy and duration of mosquito ...

A: *Mosquitoes are vectors for mamy diseases like malaria and chikungunya abd Zika virus and yellow fev...

Q: Explain the blunt-end fragments ?

A: Introduction A restriction enzyme, also known as a restriction endonuclease or restrictase, is an en...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A:   Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: Question 3. An abnormally high levels intracellular tangles are observed to occur in the brains of p...

A: Q3.Tangles are seen in the cytoplasm of dead and dying nerve cells.  They are composed of twisted st...

Q: It is important to mention there are benefits of gene patenting. Regarding diseases that do not yet ...

A: Patents: it is a right from the government for manufacturing and sell any new and useful things such...

Q: Mutations in the genes for clotting factor VIII and IX cause hemophilia A and B, respectively. A wom...

A: Hemophilia A and B are the most common types of hemophilia, affecting men more than women. Hemophili...

Q: Miguel went to the dentist, who performed a procedure that eliminated his tooth pain. The next time ...

A: Answer :- In given case , the consequence for Miguel is negative reinforcement.

Q: 11 The cell membrane is composed of phospholipids. How do the phospholipids arrange themselves withi...

A: Introduction :- The cell membrane is also known as the plasma membrane. It is the membrane that can ...

Q: why are gram-negative bacteria unevenly distributed on a slide?

A: why are gram-negative bacteria unevenly distributed on a slide?.   Introduction: Bacteria that do no...

Q: Current focus in bioethics.

A: The current focus in bioethics is the health care.  The medical field mainly focuses on the health c...

Q: What is the purpose of using an “outgroup” when reconstructing a phylogenetic tree? (Write 4 points)

A: The outgroup is used as a point of comparison for the ingroup and specifically allows for the phylog...

Q: Pt the events of action potertl generstion in the onder tut they occur from fst ) to last (S wved ot...

A: * Action potential is a when s cell was activated by stimulus  reversal in electrical potential acro...

Q: Which among the processes below will be used during heat defense? vasodilation and thermogenesis O s...

A: vasodilation work against heat as sweating does  When heat produce in body to balance the body tempe...

Q: QUESTION 9 The function of DNA polymerase in the process of DNA replication is , O a. to prevent the...

A: Answer: The function of DNA polymerase in the process of DNA replication is b. to catalyze the addit...

Q: What is Arthrobacter luteus ?

A: Prokaryotes are organisms with no well-defined nucleus.  

Q: If you could replace all of the plant ATP synthase with ATP synthase enzymes from animal cells, orie...

A: Chemiosmotic hypothesis explains the mechanism by which ATP is synthesized by the ATP synthase compl...

Q: . The production of pigment in the outer layer of seedsof corn requires each of the three independen...

A: Let Pr be purple, pr be red and acr be yellow. Part A. The phenotype of parent  P1 = AA CC RR prpr ...

Q: At what stage of the culture should bacterial colonies be harvested for plasmid DNA extraction? How ...

A: Plasmid training is a way of DNA extraction and purification for plasmid DNA. Many techniques were e...

Q: MLS supervisor is writing an Standard Operating Procedure (SOP) for running a PC test for Hepatitis ...

A: 1. Ongoing quantitative PCR for HBV DNA DNA was extricated from 200 μL of serum utilizing the QIAamp...

Q: Choose any microorganism from the different groups of cellular and acellular and give the scientific...

A: Introduction:- Bacteria, fungus, archaea, and protists are examples of microscopic creatures. Microo...

Q: rforming PCR below with 1 as the

A:

Q: What is the formula for net primary production (NPP)? How does NPP relate to energy pyramids?

A: Introduction In this question we have to write the formula for net primary production (NPP) and have...

Q: Male Reproductive System: Complete the table Letter Structure Function A А prostate gland I B В vas ...

A: Introduction: • The prostate gland is a chestnut-shaped gland located between the bladder and penis ...

Q: Four homozygous recessive mutant lines of Drosophilamelanogaster (labeled 1 through 4) showed abnorm...

A: Introduction Heterozygous means that you have inherited various versions of a gene from each parent....

Q: Which of the following statements about the lac operon is correct? 1. lacZ, lacY and lacA proteins a...

A: Introduction :  Lac Operon -  Regulatory gene is Lac I . Structural genes are lacZ,  lacY and lacA. ...

Q: Do these phylogenies depict the same relationships among taxa? Explain yes nd why. * А C B A CB

A: The polyphyletic taxon consists of a group of organisms that share similar characteristics but do no...

Q: Suppose that 100 cattle were allowed to graze in either one of two pastures. If the grass were three...

A: Introduction The term "pasture" refers to land that is used for grazing. Pasture lands are enclosed ...

Q: Brainstem-Controls breathing and heart rate Test 1: Whole Brains (not to scale) Mouse Cat Baboon Hum...

A: Cerebellum is the part which is located at the back of brain underlying the occipital and temporal l...

Q: . The genotype r/r ; p/p gives fowl a single comb, R/− ; P/−gives a walnut comb, r/r ; P/− gives a p...

A: Comb in poultry is defined by two genes usually designated as R and P.  When only the dominant allel...

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.