A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence: GTT GTC CAC TCG A mutation in the above sequence involved the deletion of a single base, leading to a shift in the reading frame of the gene, resulting in an incomplete protein. Which of the following gene sequences exemplifies the mutation described above? Select one: a. TT GTC CAC TCG b. GTT GAT CCA CT c. GT ATC CAC TCG d. ATT GTC AC TCG

A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence: GTT GTC CAC TCG A mutation in the above sequence involved the deletion of a single base, leading to a shift in the reading frame of the gene, resulting in an incomplete protein. Which of the following gene sequences exemplifies the mutation described above? Select one: a. TT GTC CAC TCG b. GTT GAT CCA CT c. GT ATC CAC TCG d. ATT GTC AC TCG

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash. Do not put a space in between characters so that LMS will recognize your answer. Message Strand +1 5-TAGTAGGCGGCATGTTTTCCCATACAGATGAAGGATAAACTCGTCT[x]TAT-3' [x]-cleavage site for CFI/CFII endonuclease (for RNA) Genetic Code: Second letter с A G UAUTyr UGC Cys UAC. UAA Stop UGA Stop UAG Stop UGG Trp CAUT CGU CAC His CGC CAA CGA Arg Gin CAGJ CGG AAU Asn AGU Ser AAC. AGC AAA AGA AAG Lys AGG Arg GAU GGU Asp GACJ GGC GAA GGA Glu GAGJ GGG] First letter כ A G U UUU UUC UUA UUGL CUU CUC CUA CUG AUU AUC lle AUA AUG Met GUU GUC Val GUA GUG Phe Leu Leu UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Gly DUAU DUAU DURO DURO A G Third letter
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
Given the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the cDNA, mRNA, tRNA anticodons, and Give the amino acid sequence. What are the three possible outcomes if a Base Substitution mutation were to occur to the template?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG mRNA Amino Acids UUA= leucine GAC= asparginine GGU= glycine GGC= glycine CCA= proline
Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the following sense strand of DNA: 5'-AUG UCU GAC UAG TTG GAT CCC - 3' Second position First position (5' end) Third position (3' end) Phe Ser Tyr Cys U Phe Ser Тут Cys Leu Ser Stop Stop A. Leu Ser Stop Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg Ile Thr Asn Ser U Ile Thr Asn Ser Ile Thr Lys Arg A Met Thr Lys Arg Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly O a. Lys-His-Ala-Gly-Asn-Leu-Val O b. Val-Val-Ser-Pro-Leu-Asp-Thr
Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAA
Help me please
The following gene sequence of nucleotides is found on the template (non-coding) strand of a molecule of DNA from a bacterial cell. The promoter of the gene is highlighted in bold letters and the +1 is underlined. Use the genetic code at the end of this packet to answer the following questions. 3'-AGGCATATTACGATGCCGGTACTTGATGATGACGGACCCATTATAGGACATATG-5' a) What is the sequence of the mRNA strand that will be transcribed from this piece of DNA? Indicate which is the 5’ and which is the 3’ end of the mRNA. b) What is the amino acid sequence that will be translated from this piece of DNA
The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?