A Sanger product seque mplate presented +ddTTP +ddATP +ddCTP +ddGTP Mononucleotide Pentanucleotide Trinucleotide Dinucleotide 11-nucleotide Hexanucleotide Octanucleotide Tetranucleotide 16-nucleotide Decanucleotide Nonanucleotide Heptanucleotide 17-nucleotide 15-nucleotide 13-nucleotide 12-nucleotide 18-nucleotide 20-nucleotide 14-nucleotide 19-nucleotide 21-nucleotide 1. Determine the sequence of template DNA 2. Determine the mRNA sequence from this template DNA 3. Determine the the sequence of protein product derived from that DNA

Q: Draw a stylized diagram of double-stranded DNA. Use a pentagon for sugar, a circle for phosphate and…

A: DNA STRUCTURE:- DNA structure is given by Watson and Crick, who proposed the double-helical…

Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…

A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…

Q: Complete the attached table representing structural characteristics of A, B and Z DNA duplex. A form…

A: DNA can exist in several forms .There are three major forms of DNA are A-DNA, B-DNA and Z-DNA. The…

Q: DNA template A complementary DNA primer Single-stranded RNA template Four deoxynucleotides (DATP,…

A: Introduction:- The process of determining the sequence of nucleotides (As, Ts, Cs, and Gs) in a…

Q: Transcribe and Translate the DNA strand: ORIGINAL DNA TAC/ACC/TTG/GCG/ACG/ Strand: RNA strand: Amino…

A: Transcription is the process in which m RNA is synthesized and the translation is the process in…

Q: Write the complementary DNA strand for the following DNA base sequence: 5' СТСААG 3' 3' 5'

A: Central dogma consists of replication, transcription and translation.  Replication is the synthesis…

Q: Word bank: Uracil Ribose R. Double-stranded Deoxyribose Thymine Single-stranded Made up of…

A:

Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT

A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…

Q: 3. Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…

A: Hi, Thankyou for posting your question on Bartleby. As per the guidelines we are allowed to answer…

Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…

A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…

Q: Two base pairs of double-stranded DNA are shown in the figure. Use your knowledge of base structure,…

A: DNA  In DNA there are 4 bases  Adenine, Thymine, guanine and cytosine.  Adenine binds with Thymine…

Q: Sequencing of the following fragment of single-stranded DNA needs to be undertaken using the Sanger…

A: Sanger sequencing, also referred to as the “chain termination method”, may be a method for…

Q: Which of the following are possible base compositions for double stranded DNA? O A=30% G=20% C=20%…

A: DNA is composed of nucleotides which are composed of nitrogenous bases, a pentose sugar, and…

Q: Match the following terms with their correct definition. The structure of double-standed DNA Hold…

A: Answer. The monomeric units of nucleic acids are called nucleotides. Nucleic acids, therefore, are…

Q: Which of these statements is correct regarding the complimentary sequence to this DNA strand: 5' -…

A: Nucleotide are elemental unit that forms genetic material that is DNA and RNA . It consists of :-  I…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: Complete the table below to show the differences between a DNA molecule and an RNA molecule.…

A: Given:  Differences between DNA molecule and RNA molecule.

Q: Consider a portion of double-stranded DNA with the complementary sequence of base pairs shown. Write…

A: DNA is genetic material in most of living organisms. There are four nitrogenous  bases present in…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Whatis the purpose of the dideoxynucleotides in DNA sequencing? OCH2 base - OCH2 base H. H. H. H. H.…

A: ddNTP(dideoxynucleotide triphosphate) used in sanger dna sequencing .which terminate the…

Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: For each term in the left column, select the term which best matches. 1. deoxyribonucleotide 2.…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: Yu raach aitantin a ab tht studies mucleic acids. Your advisor gave you four tubes for analysis.…

A: Each organism have a genetic meterial by which they regulate, inherited and constant their…

Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5…

A: DNA stands for deoxyribonucleic Acid. It is a long polymer of deoxyribonucleotides. It is found in…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: Given the DNA sequence; 3’-GCTACGTCGC-5’ 5’-CGATGCAGCG-3’ What is the total number of hydrogen…

A: Hydrogen bonds: The electrostatic force of attraction which involves Hydrogen atom.

Q: The Sanger products in the sequencing of a template DNA is shown below: +ddTTP +ddATP +ddCTP +ddGTP…

A: Sanger method of DNA sequencing is a chain termination method of DNA sequencing in which…

Q: Match the following terms with their correct definition. The structure of double-standed DNA Hold…

A: Monomers are the simpler units which joins to each other to make polymers. There are many polymers…

Q: In a sample solution given to be analyzed; CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and…

A: DNA or deoxyribonucleotide chain is a double helical structure, containing nucleotide monomers,…

Q: 1. Name the first complementary base from the 3' direction. 2. Name the fourth nucleotide from the…

A: The nucleic acids are composed of nucleotides that is the combination of sugar, phosphate and…

Q: Give the DNA compliment to the following DNA strand. ATG UAC b. TAC GTG OMG

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Please help me to write the complementary strands of the following: 1. A strand of DNA has the base…

A: The double-stranded structure of DNA is formed by matching the complementary base pairing.

Q: sugar green, nitrogenous base as follows: adenine= yellow, thymine = red. And cut the shapes of each…

A: DNA replication is process where DNA makes multiple copy of it's genome and produce same identical…

Q: Which of the following caps contains  two methylated bases?   a. 0   b. 1   c. 2   d. 3

A: mRNA cap is defined as the modification at the 5' end of the RNA polymerase II-transcribed RNA. This…

Q: A palindrome is a sequence that is read the same on both strands in the 5’—>3’ direction Question:…

A: A palindrome sequence is commonly used in biotechnology. It is the location of 6 or 7 or 8 base…

Q: Identify the level of DNA structure associated with the sequence of nucleotides. tertiary secondary…

A: Answer:- The correct answer for this question is Primary structure. The nucleotides which when…

Q: Show the separation pattern of the following DNA molecules on 1 % agarose gel. Justify your results.…

A: Introduction:  Agarose gel electrophoresis is a molecular biology technique to analyze and separate…

Q: Translate the following opposite strand of DNA based on the nucleotide bases. ATTGACTGG

A: The genetic code is a series of three-letter nucleotide combinations called codons, each…

Q: Does 5-bromouracil cause a transition or a transversion?

A: The transition mutation refers to a point mutation that replaces purine with another purine or…

Q: Complete the complementary stand of the DNA shown Complementary strand стАG GTAC TCAC G

A: It is the DNA strand in which the sequence if the constituent molecules on one strand matches the…

Q: Consider the following DNA molecule: ACG GTACACTTAC GA A T GCCAT G T GA A TG CTT 1) Draw the 2…

A: DNA stands for deoxyribonucleic acid. It is a nucleic acid, a polymer of nucleotides. A nucleotide…

Q: A strand of DNA has the sequence 5'-AGTC-3'. What is the sequence of the complementary strand in the…

A: The DNA has two strands which are comprised of nucleotides- A stands for adenine, T stands for the…

Q: Figure 3: BestrictriOR site map showing the following: A) linear DNA that is not cut as reference B)…

A: Restriction enzymes cut the DNA (deoxyribonucleic acid) at specific sites. These enzymes recognize…

Q: Give the DNA compliment to the following DNA strand. CTA a DNA BTW GAT СТА

A: DNA is the Genetic meterial which found in eukaryote and some prokaryotes. It is mainly double…

Q: DNA Sequence:     TAC  TCC  GGC  TCT  CCC  AGT  TGA  ACT Mutated Sequence: TAC  TCC  GGC  TCT  CCC…

A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…

Q: Using Chargaff’s rule of base pairing determine the amount of guanine in 120 bp long fragment of…

A: According to Chargaff's rules, DNA from every species of any organism should have a 1:1…

Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…

A: Polynucleotides The word polynucleotides can be split into two words "poly" which means "many" and…

Q: Give a clear handwritten answer and explain

A: The DNA and RNA are nucleic acids that are composed of nucleotides. Nucleotides are made up of…

Q: Overall, a molecule of DNA has a negative charge. Which component of DNA gives it this charge? Refer…

A: DNA is a double stranded molecule. Each strand of DNA is composed by polymerisation of…

Q: Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:…

A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.