Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5'-CTTGGATATC-3'
Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…
A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…
Q: What sequence of bases on one strand of DNA is complementary to the following sequence on another…
A: Complementary bade pairs It is the phenomenon where in DNA Guanine always hydrogen bonds to…
Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…
A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…
Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…
A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…
Q: If one strand of DNA has a sequence of TCAG, then the sequence of bases on the complementary strand…
A: DNA is double stranded where the two strands are antiparallel and follows complementary base…
Q: Write the complementary DNA strand for the following DNA base sequence: 5' СТСААG 3' 3' 5'
A: Central dogma consists of replication, transcription and translation. Replication is the synthesis…
Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…
A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…
Q: Two base pairs of double-stranded DNA are shown in the figure. Use your knowledge of base structure,…
A: DNA In DNA there are 4 bases Adenine, Thymine, guanine and cytosine. Adenine binds with Thymine…
Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…
A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…
Q: H. HD N. A N- H- H. 0=P-0- CH2 H. H. H. OH) H B. Where would this nucleotide hydrogen-bond to its…
A: Each nucleotide is a monomer of nucleic acid such as RNA and DNA. The RNA and DNA differs from each…
Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…
Q: Label the 5' and 3' end of each nucleotide and approximate where the start point (+1) would be on…
A: The process shown here is called transcription. In this process a molecule of mRNA is synthesized…
Q: Describe the double stranded structure of DNA with proper diagram.
A: Introduction : DNA or Deoxy ribonucleic acid is the genetic material which is present in all living…
Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…
A: The central dogma of molecular biology is the metabolic process in which the double-helical…
Q: Give
A: Introduction:- The central dogma of biological sciences explains how genetic information is…
Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…
A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…
Q: Match the label on the left with the correct structure number in the DNA molecule in the image…
A: The given structure is of a alpha helix DNA. The DNA is composed of nucleotides. Nucleotide - The…
Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…
A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…
Q: Match each DNA component to its corresponding point of attachment. 1. carbon 3' 2. carbon 5' 3.…
A: Deoxyribonucleotide (DNA) is a molecule containing all the genetic information needed to make each…
Q: What type of bond is the arrow pointing to in this image of DNA? -Hydrogen Bond -Covalent Bond…
A: DNA is a molecule that was discovered in the late 1860s by Friedrich Meischer in the nucleus but its…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…
A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…
Q: Create the complementary strand for the DNA strand. ATTTGGTT
A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: 3. 3' CTT TCT TGT AGT TẠC CGG GTA GAA TAG TTG CTG ACT 5'
A: DNA is the genetic material of most living organisms. The DNA is inherited from the parents and it…
Q: Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b)…
A: Restriction endonucleases may cut DNA. The ends of the DNA may be blunt or sticky. A straight cut…
Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…
A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…
A: A complementary strand of DNA is constructed based on base complementarity. Complementarity is…
Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…
A: Answer
Q: A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will…
A: During transcription process, the strand used as template is known as template strand which sets in…
Q: A DNA antisense strand contains the following nucleotide base sequence: ATC CAA GAC TGG From this,…
A: DNA refers to deoxyribonucleic acid. It is the genetic material of almost all organisms, except a…
Q: Tabulate the differences of the various DNA conformations in terms of orientation, rise per base…
A: The DNA duples model proposed by Watson and Crick was right handed spiral known as B-DNA. apart from…
Q: Look at the image of the the dinucleotide (two nucleotides joined togethr in a single strand). Base…
A: Nucleotide are the basic building blocks of DNA. A nucleotide consists of a sugar, nitrogenous base…
Q: Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester…
A: The form of DNA, known as a double helix, is made up of two connected strands that loop around one…
Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…
A: DNA is the protein in all living organisms that convey genetic information.
Q: What is the term applied to the trinucleotide shown by the arrow? 5' AU Ру AGGCC G C G G G ACCACCUGe…
A: This a structure of tRNA, The tRNA molecule has a distinctive folded structure with three hairpin…
Q: in DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…
A: DNA strand is made up of 4 nitrogenous bases i.e adanine, thymine, guanine & cytosine.
Q: Write the base sequence in a complementary DNA segment if each original segment has the following…
A: The cell is the basic primary unit of life for all living organisms. Inside this, the nucleus is the…
Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…
A:
Q: Describe the way in which DNA is folded. give at least 5 points
A: DNA or deoxyribonucleic acid is a biomacromolecule molecule that stores genetic information in most…
Q: Indicate the correct base order for the complementary DNA strand by placing the correct label in…
A: A DNA strand is formed of nitrogenous bases also called nucleobases. There are 4 nucleobases viz.…
Q: If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite…
A: DNA is the genetic material that involves the transfer of information from one generation to the…
Q: Fill in the palindromic sequence of the given DNA strand containing six bases.
A: A palindromic DNA sequence is a sequence made of nucleic acids with double helix of DNA /RNA that…
Q: Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis,…
A: DNA are double helical structures that contains genetic information, which is responsible for almost…
Q: Fill in the blank with the most appropriate term that is described by the following statement:…
A: The components of DNA replication. A five-membered, oxygen-containing ribose sugar ring with three…
Q: Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis,…
A: Transcription of DNA into mRNA and translation of mRNA into protein is known as the central dogma of…
Step by step
Solved in 2 steps
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixGive the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
- Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-CTTGGATATC-3'Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCGWrite the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'
- Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-GWhat is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?