4.) Below is a replication fork. This is half of a replication bubble. 3' 3' a. Draw a circle to indicate the location of the helicase and an arrow to show the direction it is moving. b. On each DNA template, draw just one RNA primer (short, thick line) and the new DNA (longer). Label 5' and put an arrow head on 3' ends. c. The top strand would be the circle one: (leading strand / lagging strand) d. RNA primase and helicase are both what type of biomolecules (polymers). e. is the catalyst that adds new nucleotides of DNA.

4.) Below is a replication fork. This is half of a replication bubble. 3' 3' a. Draw a circle to indicate the location of the helicase and an arrow to show the direction it is moving. b. On each DNA template, draw just one RNA primer (short, thick line) and the new DNA (longer). Label 5' and put an arrow head on 3' ends. c. The top strand would be the circle one: (leading strand / lagging strand) d. RNA primase and helicase are both what type of biomolecules (polymers). e. is the catalyst that adds new nucleotides of DNA.

Name: 4.Below is a replication fork. This is half of a replication bubble.3
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 4.Below is a replication fork. This is half of a replication bubble.3'3'a. Draw a circle to indicate the location of the helicase and an arrow to show the direction it ismoving.e.b. On each DNA template, draw just one RNA primer (short, thick line)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 22QP: Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3...

See similar textbooks

Similar questions

Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
1. Draw a DNA helix opened up to copy a single gene (CAREFUL this is NOT a replication bubble). You can make lines straight and parallel if you would like 2. On the bottom strand starting in middle and pointing to the left, draw a 90 degree arrow to show the start of transcription. 3. Add 10 DNA bases of your choice (A,T, C or G) along the bottom line to left of the 90 degree arrow. 4. Add the complementary DNA bases along the top line. 5. Beginning at the 90 degree arrow, transcribe the DNA into RNA. Write the appropriate letters. Label this as mRNA 6. Label 5' and 3' ends of all nucleic acids. 7. Label the template strand and the coding strands of DNA. 8. Label the promoter. (Upload steps 1-8 but on your own please practice all 4 possible flips of this. Arrow on bottom facing left or right. Arrow on top facing left or right.)
1. The diagram below depicts a DNA replication fork in a biological cell. The primer is shown by an arrow 5'-3'. A ATTATGTCTGGCCTTGAGTAAGGCTAATCACAT GCGTA GCAT Primer BTAATA TCATTC CGATT From the DNA diagram above, which ends (indicated as A, B, C & D) of the DNA template strand are the 5' and a. which are 3' ends? b. Which way is the direction of movement of the replication fork? Right or left of the figure. Which of the parental strands are the templates for leading (continuous) and lagging (discontinuous) strand synthesis?. Top or bottom strand. С. I d. Give the sequence of the five base long primer that is shown as an arrow in the diagram above 5' 3' Give the sequence of the next four bases that would be added to the growing end of the primer e. 5' 3'
10. A picture of a replication bubble is shown below. でイトイOpイ TT 3 Primer 5'-CUU-3" is being used to replicate this picce of DNA. What strand this primer will anneal to: the upper or the lower? Write what product of RNA replication would be the first five nucleotides that had been added onto the primer by DNA pol. Mark the 5' and 3' ends. lin
6. The following diagram shows a replication bubble within a double stranded DNA molecule. The red arrow shows the direction of the primer. AAAGIACGTIGAC ATTGGCC 3' TAACCGG 5' 5' GTCCGAC 3' CAGGCAG C. 5 CAT&CAACTO a. What is the sequence of the red RNA primer? b. If the replication fork moves to the left (left side opens more), will this primer be used to create the leading strand or lagging strand? Please explain your answer. If you answered the leading strand, explain why replication is continuous. However, if you answered lagging strand explain why replication is discontinuous.
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
1. Draw a replication fork in the space below. Be sure to label the 5' and 3' ends of the DNA on both strands.
6. Below is an image of a DNA replication fork. a. Label the leading and lagging strands as well as the 5' and 3' ends for each of the arrows on the newly synthesized DNA. DNA replication fork DNA unzips b. Explain why Okazaki fragments only form on the lagging strand during DNA replication.
You are presented with the following DNA molecule: 5’ A T G C G A T T A T A A 3’ 3’ T A C G C T A A T A T T 5’ A. Write the template DNA strand B. Transcribe the template DNA strand into mRNA C. Translate the mRNA into an amino acid sequence
1. DNA polymerase A. Short DNA sequences synthesized on the lagging strand 2. replication fork B. Replicated discontinuously in the 5' to 3' direction 3. Chromosome C. The structure made of DNA that carries genes 4. free nucleotides D. The Cs, Gs, Ts, & As ready to be added to growing chain 5. Topoisomerase F. The Y-shaped point of origin for DNA replication 6. Okazaki Fragment G. Manages the overwinding of DNA ahead of the fork 7. Leading strand H. Lays down nucleotides in DNA replication 8. Lagging strand I. replicated continuously in the 3' - 5' direction
33.Choose the DNA nucleotide sequence that would be complementary to the following strand (note: pay attention to DIRECTION of replication): 5' GTAGTCA 3' a 3' UATUAGA 5' b. 5' TGACTAC 3' 3' ACGACTG 5' 5' UGACUAC 3'. 5.Using agarose gel electrophoresis to analyze DNA, short DNA travels the long DNA. a faster than slower than at the same speed as d. Question 6 Which type of bonds link the individual nucleotides together in DNA? Glycosidic bond Peptide bond Phosphodiester bond Electrostatic bond a e Hydrogen bond Question 7 A typical engineered plasmid vector often contains the following features except a A poly linker region Origin of replication A signal peptide An antibiotic resistant gene a. b. C. C. d.