3r 5' C ACAA AGGAAT Primer 5'-CUU-3' is being used to replicate this piece of DNA. What strand this primer will anneal to: the upper or the lower? Write what product of RNA replication would be the first five nucleotides that had been added onto the primer by DNA pol. Mark the 5' and 3' ends.
Q: The following represents a DNA strand in the process of replication. The bottom sequence is that of…
A: DNA replication is the process in which a copy of already existing genome is formed. A pair with T…
Q: This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation…
A: A mutation refers to any alteration in the sequence of DNA (deoxyribonucleic acid) due to some…
Q: polymerase with 5'-3' as well as 3'-5' exonuclease and proofreading activity is Select one: a.…
A: The error-correcting processes used in the genetics is known as the proof reading. During the…
Q: If this is the original sequençe of a DNA strand: CCAGGTCCATGACTTAGC, how would you labeled the one…
A: It is an alteration in the nucleotide sequence of the genome of an organism.
Q: Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) origin of…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: ЗА. This DNA after Bsal digestion, produces a DNA fragment with sticky ends as shown in the figure…
A: Introduction :- DNA strands are digested with the help of various restriction enzymes .Bsal is an…
Q: DNA polymerase I DNA polymerase II DNA ligase Primase RNA primer 5' Lagging strand 3' 3' Okazaki…
A: The process of copying of double stranded DNA by the application of several Enzymes and proteins…
Q: In ONE sentence define the function of the following 1. SSBS = The SSBS are single 2. Beta subunit…
A: These are all the enzymes used in replication of DNA Replication of DNA is a very important process…
Q: 4.8. The figure below shows a snippet of DNA in the process of being replicated. The RNA primer is…
A: DNA replication is the process by which DNA makes a copy of itself during cell division. In order to…
Q: A K I D H
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: 1 Annotate Figure 16.5, which is a schematic of the replication fork. a. In each box, write the name…
A: DNA replication The process by which DNA duplicate itself.
Q: Three identical DNA molecules, made up of 40 nucleotides each, all have their thymine nucleotides…
A: The replication of DNA refers to making copies of the DNA molecule. In the semi-conservative mode of…
Q: The following nucleotide sequence is found in a short stretch of DNA:5′–ATGT–3′3′–TACA–5If this…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: 12. A sequence of nucleotides is shown below, along with an indication of an origin of replication:…
A: Replication is the process of synthesizing new DNA from the parental DNA.
Q: What does it mean to say thhat extension by DNA polymerase III proceed 5'---3'? A. The 5' end of a…
A: 5' end or five prime end is the end of DNA or RNA strand and has the fifth carbon in sugar ring of…
Q: Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired…
A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…
Q: DNA polymerase III (the main polymerase) Helicase DNA ligase Single-stranded binding proteins DNA…
A: DNA replication is the process by which new DNA strands are produced from the old DNA strands by the…
Q: This is the original strand of DNA: ATG AAG TTT GGC TAA Which option would represent a frameshift…
A: Mutations are any change in the nucleotide sequence in DNA or rna molecules.
Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…
A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…
Q: Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired…
A: The process of creating a copy of DNA is referred to as DNA replication. In a eukaryotic cell, this…
Q: CHOICES: Isoniazid Rifampicin Ethambutol None of the Choices Binds to bacterial DNA gyrase &…
A: DNA gyrase is an important enzyme that allows the bacteria to supercoil its NDA. The DNA gyrase is…
Q: Where are the Okazaki fragments found? Lagging Parental Strand Topoiso- merase Helicase Single…
A: We'll answer the first question since the exact one wasn't specified.please submit a new question…
Q: Considering that DNA is synthesized in the 5' to 3' direction, which direction must DNA polymerase…
A: Introduction: Biological information is transferred from DNA to RNA and then to proteins. This is…
Q: Drag an arrow in the appropriate direction of travel for DNA Helicase Replication fork Trihoshate…
A: The course of replication is done with the assistance of various enzymes, for example, helicase, DNA…
Q: Sall Kpnl Kpnl 450 600 200 400 1650 1. If you were to subject this digested DNA to agarose gel…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a)…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: Fill in the blank. As helicase unwinds closed circular DNA, it compensates for positive…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Direction of new synthesis Ticket-out: Newly synthesized strand Something is wrong with replisome…
A: Through the diagram, we can observe that DNA polymerase III is acting on the parental strand and it…
Q: How many subunits does the E. coli DNA polymerase I have? Soloct onot
A: Option(d) 1
Q: Which of the following reactions is required for proofreading during DNA replication by DNA…
A: DNA polymerase III is the primary enzyme complex which is involved in prokaryotic DNA replication.…
Q: Referring to Figure 7-20, answer the following questions:a. What is the DNA polymerase I enzyme…
A: DNA replication can be described as the process involved in making copies of DNA. This process can…
Q: A single (+) strand of DNA (base composition: A, 21%; G, 29%; C, 29%; T, 21%) is replicated by DNA…
A: Hi, Thanks For Your Question. Answer : DNA Is The Genetic Material Which Stores All The Biological…
Q: Escherichia coli's chromosome has a replication origin called OriC. Draw a schematic diagram to show…
A:
Q: 5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication…
A: DNA =Deoxyribose Nucleic Acid It is so named because there is no oxygen in the 2' end of ribose…
Q: I need question 41
A: Central dogma of life involves the way in which proteins are synthesized from double stranded DNA.…
Q: Drag an arrow in the appropriate direction of travel for DNA Helicase Repilication fork Triphosphate…
A: During the DNA replication, the double helix structure of the DNA needs to be breakdown into a…
Q: Please help me with the orange question. My answer is leading strand will encounter lagging strand.…
A: DNA replication takes place in a bidirectional mode in which both strands are replicated…
Q: All ingredients required for the synthesis of DNA were placed in a test tube. The primer has the…
A: This is the working process of DNA dependent DNA polymerase. DNA polymerase synthesize new DNA…
Q: Taq polymerase is a bacterial thermostable DNA polymerase that has a relatively low replication…
A: Taq polymerase is an enzyme used to amplify DNA in Polymerase chain reactions. Taq polymerase is a…
Q: most likely 11 nucleotides on this strand that serve as the replication origin
A: According to Chargaff's rules of base pairing stoichiometric ratio of purine and pyrimidine bases…
Q: Why does DNA replication only occur in the 5’ to 3’ direction? (A) 5' 3' (B) 5' 3' Should be PPP…
A: The central dogma of the cell is the process of the transfer of genetic material from DNA to…
Q: On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material that contains thousands of…
Q: Does 5-bromouracil cause a transition or a transversion?
A: The transition mutation refers to a point mutation that replaces purine with another purine or…
Q: The following nucleotide sequence is found on the template strand of DNA. First, determine the amino…
A: Amino acids are the amine groups consisting of carboxylic acids and a side chain which forms the…
Q: Label the parts of the DNA replication fork. DNA ligase Leading strand Okazaki fragment DNA…
A: DNA replication, as used in molecular biology, is the biological method for creating two identical…
Q: Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs. Does Sanger…
A: Sanger sequencing is the method of sequencing (determining the sequence of DNA) of DNA using the…
Q: 1. (a) An E. cofi DNA plasmid has 5.64 x 10 base pairs. The plasmid contains a single origin and a…
A: DNA replication is the process of producing two identical copies of DNA from one double stranded DNA…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?Below is a list of "solutions" to problems encountered when bacteria replicate DNA. Match the "solution" to the specific "problem" encountered during DNA replication ligase Choose] [Choose ] helicase conversion of ds DNA into ss templates relief of chromosome supercoiling Primase synthesis of short primer replacement of RNA with DNA synthesis of most of DNA DNA Polymerase I using RNA as template to make DNA covalent linkage of Okazaki fragments Bacterial GyraseBelow is a list of "solutions" to problems encountered when bacteria replicate DNA. Match the "solution" to the specific "problem" encountered during DNA replication ligase [Choose ] [Choose ] helicase using RNA as template to make DNA conversion of ds DNA into ss templates Primase synthesis of most of DNA replacement of RNA with DNA DNA Polymerase I relief of chromosome supercoiling synthesis of short RNA primer protection of ss DNA templates DNA Polymerase III covalent linkage of Okazaki fragments Bacterial Gyrase [ Choose ] SSBP's [ Choose ]
- 1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.(d) Write down the sequences of the templates that would give the tetranucleotides shown in I and II. In each case, label the 5' and 3' ends and indicate which template base is used first. (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable? I IIMatch the enzyme on the left with its role in DNA replication DNA polymerase I helicase DNA ligase DNA polymerase III topoisomerase primase 72 W w# 3 E $ 4 R % 5 T A 6 MacBook Pro Y & 7 U * 8 replaces primers with DNA connects Okazaki fragments to form a continuous strand of DNA synthesizes short RNA fragments used to initiate DNA synthesis Uses the 3'OH of an RNA primer to synthesize the leading strand and Okazaki fragments keeps DNA from getting tangled up ahead of the replication fork "unwinds" the DNA double helix at the origin and replication forks 1 ( 9 X 0 0 P + 11 Next
- Below is a picture of a single origin of replication in a eukaryotic cell. 5' 3' 5' 1. On the figure above, Draw out where the following molecules will be located: Helicase; Sliding Clamp, Single Strand Binding Protein. 2. On the right hand side of the dotted line, the replication of which template strand (top or bottom) will be continuous by DNA polymerase? 3. On the left hand side of the dotted line, the complete replication of which template strand (top or bottom) will be more affected by a mutation that causes DNA ligase to be partially functional?Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)32)An origin of replication is given below. Sequences of selected parental strand regions are given. The directionality of the bottom parental strand is indicated. Use the diagram to answer the corresponding questions. #2 *1 CTAAGCA ATCGAGG XXXXX XXXX 3' ICTAGTT 5' ge exon #3 a.) On the diagram, label the 5' and 3' end of the top strand of parental DNA b Draw arrows to indicate direction of DNA synthesis for each of the 4 daughter strands. e) For each daughter strand, specify if synthesis is continuous or discontinuous. d) On your diagram, label the 5' and 3' ends of the newly synthesized daughter strands e.) Which parental strands are the template for leading strand synthesis? (# 1- 4) Strand # Strand # f.) Which parental strands are the template for lagging strand synthesis? (# 1- 4) Strand # Strand # g.) What is the specific sequence of the primer required to start DNA replication ior strands 1 and 3? Assume the primer will bind to the location where the base sequence is given on…
- The figure at the right shows a partially drawn replication fork. a) Annotate this figure to show the proper location of each of the following: • template DNA strand polarity • DNA polymerase I Topoisomerase (gyrase) • leading strand daughter fragment(s) lagging strand daughter fragment(s) Single stranded binding proteins • DNA polymerase III • Primase • Ligase • HelicaseMatch the following (most appropriate combinations): helicase Topoisomerase DNA Polymerase III DNA Polymerase I Primase [Choose ] Replicates bacterial chromosomes Separates DNA strands Changes Supercoiling Has a 5-to-3 exonuclease activity RNA synthesis Changes Supercoiling Has a 5-to-3 exonuclease ac RNA synthesisImage 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )