39. Match the following functions to the letters in the pictureationsExcavataAmoebaSee all (5+)RhizariaO A d 3/23/2022Fungusant67'F A FRelated peopleThe Soyua of cell biology(The central dogma)B. Transription D.TranslationDNAС.BNAЕ.Protein1. A.2. B3. С4. D5. Ea. translationb. DNAc. transcriptiond. RNAe. Protein41. The template strand of a gene has the sequence 3'-TCCCATGAG-5'. Which of thefollowing would be a characteristic of the amino acid translated from the middletriplet of the sequence?a. basicb. polarc. acidicd. negativly chargede. non-polar1043. The template strand of a gene has the sequence 3'-TCCCATGAG-5'. If the geneundergoes a point mutation to the final triplet from GAG to GAC, whot would be theeffect on the amino acid sequence specified by the gene?12. (a. It would be no big dealb. This mutation is known to cause cancerc. The omino acid in that position would be changed to non-polar and the proteincould not foldd. This would produce a "stop" codon and translation would be incomplete1:51 PM45. Refert 36.In the cell depicted in the picture, the ribosome is labeledb.c.d.37. A gene mutationis none of theseb. may orise spontaneously.a change in the nucleotide sequence of DNA.isis all of these.e. moy be caused by environmental agents.c.d.1PBDACE

39. Match the following functions to the letters in the picture 67'F The doyua of cell biology (The central dogma) B. Transriphon D.Translation A. DNA BNA Е. Protein 1. A. 2. B 3. С 4. D 5. E a. translation b. DNA c. transcription d. RNA e. Protein 45. Refert ap

39. Match the following functions to the letters in the picture 67'F The doyua of cell biology (The central dogma) B. Transriphon D.Translation A. DNA BNA Е. Protein 1. A. 2. B 3. С 4. D 5. E a. translation b. DNA c. transcription d. RNA e. Protein 45. Refert ap

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 3SQ

See similar textbooks

Related questions

Q: 6. Genes Mand Nare 34 mu apart. A double heterozygote individual is crossed with an mmnn individual....

A: Distance between M and N 34 map unit That means they are linked. Double heterozygote = MmNn Rec...

Q: 11- One of the following is not a structural feature of neuron. A. Dendrites B. Node of Ranvier C. S...

A: Neurons are the structural and functional unit of nervous system. They are used to transmit impulse ...

Q: In Figure 8-6, describe where the gene promoter islocated.

A: DNA refers to a polymer of nucleotides and is double-stranded. One of the strands of DNA plays a rol...

Q: A virus has been identified that encodes a protein which inhibits the transporter-associated with an...

A: Transporter associated with antigen processing (TAP)

Q: What are the other three different types of microtome (except hand microtome). Describe and differen...

A: Microtome is an instrument which is used to thin , fine and uniform sections of specimen for the pu...

Q: In the following graph, curve (line) N represents a vascular function curve (venous return curve) in...

A: Introduction :- Venous return is the flow of blood from the periphery back to the right atrium, and ...

Q: Beta turn (B-turn) Type I and l'are shown below. The type of turn shown in the beta-hairpin structur...

A: * The beta hairpin also called as beta ribbon or beta beta unit. * Beta unit is a simple protein mot...

Q: Which of the following is NOT part of the endomembrane system? O chloroplast O plasma membrane Ovesi...

A: Introduction: A cell is the smallest unit of life which has a definite structure and a specific func...

Q: Describe Rhizopus oligosporus and Penicillium sp.

A: Kingdom Fungi Fungi are filamentous and the body consists of long slender thread like structures ca...

Q: 1. Will the water penetrate all through the sandwich? Explain. 2. Explain which layer(s) of the san...

A: The sandwich or lipo-protein sandwich model explained that cell membranes contain both proteins and ...

Q: If there is 50 bacterial colonies on a 1:1000 dilution streak plate. How many cfu/mL are there?

A: Introduction: A CFU stands for colony-forming units. It is a unit that we use for estimating the num...

Q: it

A: The measurements models are used for the determination of the relationship between the latent variab...

Q: Describe two different ways in which glucose oxidase is regulated.

A: Answer: - Glucose oxidase is a subset of oxidoreductase compounds that catalyzes the exchange of ele...

Q: • How many sperm cells will be produced by 800 spermatids? (number only) • If there are 50 secondary...

A: The secondary spermatocyte divides into 2 haploid spermatids which transforms into a mature sperm by...

Q: APPLICATION Directions. Read and perform the procedures indicated below. 1. Make a short educational...

A: Tay Sachs disease It is a disease that is caused by the insufficient activity of enzyme called beta ...

Q: Why is RNA produced only from the template DNAstrand and not from both strands?

A: The fundamental process of gene expression is transcription. Coping of information from DNA to RNA t...

Q: 9. What is the longest phase of the cell cycle. Suggest a reason for this to be the case. Before ent...

A: Since you have asked multiple questions , we will solve the first question for you. If you want any ...

Q: (a) Name the following: (i) The type of cell division which occurs in the cells of the reproductive ...

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...

Q: Explain how most cells can have the same genetic content and yet have different functions in the bod...

A: The genome of a cell contains in its DNA sequence the information to make many thousands of differen...

Q: 31- which of the following is not always a component of a reflex arc: a- effector organ C- CNS b- af...

A: Reflex action is involuntary movement in response to stimulus. Reflex arc is a neural pathway.

Q: Compare and contrast Replication of DNA in prokaryotes and eukaryotes

A: Definition: - PROKARYOTES: - Prokaryote i s amicroscopic snigle celled organism which has niether a ...

Q: Change in allele frequency of a population is called_____ . a. macroevolution c. inbreeding b. adapt...

A: The answer of this question is option d i.e. microevolution. * Change in allele frequency of a popul...

Q: One molecule of NADH results in the production of 3 ATP molecules because: a. NADH contains 3 hydro...

A: NADH It stands for nicotinamide adenine dinucleotide + hydrogen. It's an important part of the red...

Q: Use examples to explain sexual selection and its outcomes.

A: Sexual selection is a type of natural selection in which members of one biological sex choose mates ...

Q: Explain the upward migration of enterocytes in colon. What is the role of Wnt factors and beta-caten...

A: Adenomatous polyposis coli (APC) is widely accepted as a tumor suppressor gene highly mutated in col...

Q: 30- Which of the following is true about muscle contraction: a- Results by the actin sliding along m...

A: Muscle contraction us the tightening , shortening or lengthening of muscles when you do some activit...

Q: Polar bears have trouble finding prey when

A: Polar bears have trouble finding prey in summers when ice melts. Due to melting of ice, polar bears ...

Q: Why might this be stable while the variation with only sheep and wolves is not?

A: Net logo could be a multi-agent programmable modeling environment. Its utiluized by many thousands o...

Q: The allele b occurs with a frequency of 0.8 in a population of giraffes. Give the frequencye of geno...

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous c...

Q: In humans, brown eyes (B) are dominant over blue (b)*. A brown-eyed man marries a blue-eyed woman an...

A: The gametes are produced as a result of meiosis in diploid parent cell.

Q: Select physiologic factors of the ventilation-aeration system that limit VO2max and aerobic performa...

A: VO2 (or oxygen consumption) is a measure of the volume of oxygen that is used by your body to conver...

Q: 3. Where does each of the following occur in the cell? Be specific. Glycolysis- Citric Acid Cycle- E...

A: A cell can be referred to as a cytoplasmic mass that is outwardly attached by a plasma membrane. Cel...

Q: You are tasked with measuring the quantity of prostate specific antigen (PSA) in a urine sample usin...

A: Introduction: ELISA stands for Enzyme Linked Immunosorbent Assay. It is a commonly used laboratory t...

Q: How does population size affect genetic diversity? Cite one example.

A: INTRODUCTION Genetic diversity is defined as a diet of different types of hereditary featur...

Q: Describe the wood frog's adaptation which is the ability to freeze its body. Is this adaptation beha...

A: The wood frog possesses special distinct characteristics that gain the attention of biologist since ...

Q: R M

A: Sheep brain sagittal view: Introduction: A sheep's brain is extremely similar to that of a human. Ho...

Q: give one possibility of failure for the glycolysis to proceed.

A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells...

Q: In what type of solution tonicity is this plantcell in? How do you know this? What is it called when...

A: Introduction: Plasmolysis is the process in which cells lose water in a hypertonic solution.

Q: How is energy carried from glucose into the mitochondrial electron transport chain? Why is oxyge...

A: 1. The Electron Transport Chain: ATP for Life in the Fast Lane Toward the finish of the Krebs Cycle,...

Q: 15- the membrane potential if the [Na+] outside, inside = A. (+) B. (-) C. (+) D. (+)

A: Depolarization occurs when sodium ions enter inside the cell. This changes the membrane potential.

Q: Amino Acids coded Order of Bases in DNA Order of Bases in Order of Bases in MRNA (codon) TRNA (antic...

A: According to central dogma of molecular biology :- I ) DNA consists of two strand : coding and templ...

Q: THINK IT THROUGH Having solved the water depletion problem in your state, your next task is to deal ...

A: Some of the myths about groundwater are that they are inexhaustible but it is not true because if pe...

Q: In the following figure, provide RNA sequence of Gene a and Gene b in a 5'-3' direction. Provide the...

A: Non-template strand: it is also known as coding strand. It's sequences are just like RNA sequences w...

Q: Describe the adaptations of terrestrial animals that allow them to be successful on land

A: *Animals can be found every in the earth.They can live on land with diverge conditions. *They can be...

Q: One of the following Is not a characteristic of the second Active transport: a- Using the hydrolysis...

A: Active transport is the transport of solutes across a semipermeable membrane with the input of energ...

Q: 1,Show the cross between two people with Type AB blood. What is the genotypic and phenotypic outcome...

A: Introduction: Incomplete dominance is a form of intermediate inheritance in which one allele for a s...

Q: A human gene was initially identified as having three exons and two introns. The exons are 456, 224,...

A: Part A.

Q: Differentiate between TWO of the following pairs: Genetic and a restriction map Southern and colon...

A: The mapping of DNA refers to the identification of the location of particular genes. Genetic map and...

Q: Organisms living at the bottom of oceans, rivers, and lakes are all called benthos.

A: Introduction: The benthic zone, which includes the sediment surface and some sub-surface layers, is ...

Q: (iii) In terms of their modes of action at a molecular level, antibiotics and antibacterial agents c...

A: *A chemical substances produced by an microorganism that iss harmful to other microorganisms is call...

Concept explainers

Cancer Therapy

Question

39. Match the following functions to the letters in the picture
ations
Excavata
Amoeba
See all (5+)
Rhizaria
O A d 3/23/2022
Fungus
ant
67'F A F
Related people
The Soyua of cell biology
(The central dogma)
B. Transription D.Translation
DNA
С.
BNA
Е.
Protein
1. A.
2. B
3. С
4. D
5. E
a. translation
b. DNA
c. transcription
d. RNA
e. Protein
41. The template strand of a gene has the sequence 3'-TCCCATGAG-5'. Which of the
following would be a characteristic of the amino acid translated from the middle
triplet of the sequence?
a. basic
b. polar
c. acidic
d. negativly charged
e. non-polar
10
43. The template strand of a gene has the sequence 3'-TCCCATGAG-5'. If the gene
undergoes a point mutation to the final triplet from GAG to GAC, whot would be the
effect on the amino acid sequence specified by the gene?
12. (
a. It would be no big deal
b. This mutation is known to cause cancer
c. The omino acid in that position would be changed to non-polar and the protein
could not fold
d. This would produce a "stop" codon and translation would be incomplete
1:51 PM
45. Refert

36.
In the cell depicted in the picture, the ribosome is labeled
b.
c.
d.
37. A gene mutation
is none of these
b. may orise spontaneously.
a change in the nucleotide sequence of DNA.
is
is all of these.
e. moy be caused by environmental agents.
c.
d.
1P
BDACE

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making multiple copies of an mRNA molecule after it has been transcribed from DNA B. Converts a protein sequence to mRNA
20. The image above reveals two bacterial cells in the process of A. cell lysis B. transduction C. conjugation D. transformation -NAM-NAG-NAM-NAG D-Glu D-Ala D/ Transpeptidase D-Ala DAP T 1 D-Ala D-Glu L-Ala NAG-NAM-NAG-NAM FYRET E. budding K 21. Modification of the enzyme pictured (above) might result in resistance to A. quinolone B. streptomycin C. chloramphenicol D. penicillin E. trimethoprim
slation is synthesis of proteins from B. C. D. t-RNA m-RNA r-RNA DNA 41. It is a type of mutation which modifies the whole sequence of the amino acids. A. В. C. D. 42. Which of the following is a result of a genetic mutation? Inversion Additions Substitutions Replication A. Kwashiorkor Scurvy Cystic Fibrosis Marasmus В. С. D. 43. Which of the following medical condition is a result of a substitution mutation? A. Sickle cell anemia B. Tay-sach's disease C. Cystic Fibrosis D. Some Cancer 44. Lung cancer is caused by which of the following factors? A. В. Addition Inversion Substitution Polycyclic Aromatic Hydrocarbons С. D. 45. Which of the following are called mutagens А. Chemicals that induce changes in DNA В. Chemicals that induce changes in Proteins. C. Chemicals that induce changes in Carbohydrates. D. Chemicals that induce changes in Lipids. 46. Glycolyis is under of the following metabolic pathway? Chain reaction Chemical reaction Anabolic reaction Catabolic reaction А. В. С. D.…
of malaria e. More than one answer is correct During the transcription of a given portion of a DNA molecule Select one: a. MRNA is synthesized on only one of the chains b. any of the patterns may be found c. half of the MRNA is synthesized on half of one chain; then the other half of the MRNA is made on the other half of the DNA d. MRNA is synthesized on both chains of the DNA molecule, but first on one side and then the other e. MRNA is synthesized on both chains of the DNA molecule at once The nucleotides CTA were paired with the nucleotides GAU by a cell that carried out its daily activities. This pairing occurred Select one: a. when an mRNA codon paired with a TRNA anticodon b. It is impossible to say, given this information C. during transcription
There have been recurring cases of mad-cow disease in the United Kingdom since the mid-1990s. Mad-cow disease is caused by a prion, an infectious particle that consists only of protein. In 1986, the media began reporting that cows all over England were dying from a mysterious disease. Initially, there was little interest in determining whether humans could be affected. For 10 years, the British government maintained that this unusual disease could not be transmitted to humans. However, in March 1996, the government did an about-face and announced that bovine spongiform encephalopathy (BSE), commonly known as mad-cow disease, can be transmitted to humans, where it is known as variant Creutzfeldt-Jakob disease (VCJD). As in cows, this disease eats away at the nervous system, destroying the brain and essentially turning it into a spongelike structure filled with holes. Victims experience dementia; confusion; loss of speech, sight, and hearing; convulsions; coma; and finally death. Prion diseases are always fatal, and there is no treatment. Precautionary measures taken in Britain to prevent this disease in humans may have begun too late. Many of the victims contracted it over a decade earlier, when the BSE epidemic began, and the incubation period is long (VCJD has an incubation period of 10 to 40 years). A recent study concluded that 1 in 2,000 people in Great Britain carry the abnormally folded protein that causes VCJD. In spite of these numbers, the death rate from VCJD remains low. It is not clear whether this means that the incubation period for the disease is much longer than previously thought, or whether they may never develop the disease. How can a prion replicate itself without genetic material?
1. Which type of mutation results in no change in amino acid sequence for the protein? a Silent b Missense c Nonsense d Frameshift
which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruises
a.Label the diagram b.What is one differences between initiation of prokaryotic and eukaryotic translation? A A AUCG 5'TT GGGUUUACG G E B.
10. What would be the result if a cell failed to express a functional signal peptidase enzyme? a. It would be unable to import proteins into the nucleus b. It would be unable to export proteins out of the nucleus c. It would be unable to synthesize any proteins d. It would be unable to secrete proteins e. Both a and b are correct answers
I. List the sequences of RNA that would be transcribed from the following DNA template sequences. a. TTACACTTGCTTGAGAGTC Ans: b. АСТTGGGCTАTGCTCATTA Ans: c. Ans: GGCTGCAATAGCССТAGAT d. GGAATACGTCTAGCTAGCA Ans:
D. radiodurans can survive strong ionizing radiation (gamma radiation). What DNA repair process? a. Reverse transcription b. Translation c. Homologous recombination d. DNA replication e. Transcription
35. Which of the following statement relating to the cell nucleus is inaccurate? a. all body cells are nucleated b. the nuclear envelope is a non-porous double-layered membrane c. contains nucleoli that are involved in tRNA synthesis d. a and b e. a, b, and c