2. How would you recombinantly purify a human protein fromDigest DNAExpress ProteinDNA LigationAgarose GelPCR AmplificationChromatographya cell extract of mRNA? Organize the following terms.Generate cDNASDS-PAGE/WesternBacterial TransformationBlue/White Screening

In molecular biology and biotechnology, the recombinant purification of human proteins from cellular…

2. How would you recombinantly purify a human protein from a cell extract of mRNA? Organize the following terms: Digest DNA Generate cDNA SDS-PAGE/Western Bacterial Transformation Blue/White Screening Agarose Gel PCR Amplification Chromatography Express Protein DNA Ligation

2. How would you recombinantly purify a human protein from a cell extract of mRNA? Organize the following terms: Digest DNA Generate cDNA SDS-PAGE/Western Bacterial Transformation Blue/White Screening Agarose Gel PCR Amplification Chromatography Express Protein DNA Ligation

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section18.1: Key Dna Technologies For Making Genetically Altered Organisms

Problem 2SB

See similar textbooks

Related questions

Q: What is the highlighted bone structure?

A: Skull is the bony, hollow, round-shaped structure of the axial skeletal system, that protects our…

Q: The following questions refer to the pedigree chart in Figure below for a family, some of whose…

A: A characteristic or genetic condition known as an autosomal dominant trait is one that is caused by…

Q: Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each…

A: Restriction enzymes (RE) are the enzymes that recognize and cut specific sequences of DNA called…

Q: ▾ Part E The biology students in Seattle bought a second fish sample at the fish market. Which tree…

A: In taxonomy the construction of phylogenetic tree is very important. That gives us an idea about the…

Q: 1. For a single locus with two alleles, A₁ and A₂: (a) Draw a graph (using graph paper) showing both…

A: When a population is in Hardy-Weinberg equilibrium for a gene, it is not evolving, and allele…

Q: Describe how Gregor Mendel tested his pea plants to show that they were true-breeding before he…

A: Answer :- Gregor Mendel, an Austrian monk, is renowned for his pioneering work in the field of…

Q: 4.11 The mass flow of air through a supersonic nozzle is 1.5 lb/s. The exit velocity is 1500 ft/s,…

A: The problem at hand includes computing the metric area of an air-exiting supersonic nozzle. In the…

Q: The osmotic potential of the plant cell is -0.1 MPa and it is placed in an 9 mM sorbitol solution…

A: Turgor pressure is an essential feature of plants that plays a crucial role in their function. It is…

Q: Which other recommendations will any pregnant mother be given in order to prevent exposure to…

A: The manner of virus transmission is the most important phase in the dynamics of virus infections.…

Q: PCR is used for cloning DNA and after about 30 cycles, the number of copies DNA will have increased…

A: The enzyme DNA polymerase which is used for PCR reactions is called Taq DNA polymerase which is…

Q: Fill in the blank: If Lorises and Tarsiers independently evolved to eat insects, that makes their…

A: Evolution is steady phenomenon that brings about alterations in life forms from simple to more…

Q: Diffusion is incredibly important for the proper functioning of cells. Our question today is whether…

A: In order to examine the potential role of diffusion in the observed similarities in size and shape…

Q: Loretta had a broken femur. She was in a cast from her foot to her hip for a VERY long time. When…

A: Answer :- After Loretta's unfortunate femur fracture, she endured the lengthy confinement of her leg…

Q: Which structure/organ would be found deep to the parietal peritoneum serosa? Where is this serosa…

A: The serous membranes consist of two layers: the parietal serosa, which lines the walls of these…

Q: Ancient Invasions: From Endosymbionts to Organelles. provide a written summary of the major concepts…

A: "Ancient Invasions: From Endosymbionts to Organelles" is a topic that explores the fascinating…

Q: what is exaptation and co-evolution and give appropriate interesting examples (500 words).

A: Evolution is a non ending process. It is responsible for shaping the present day species and would…

Q: What is the significance of microscopy in the study of Zoology?

A: Microscopy plays a pivotal role in the field of Zoology, the scientific discipline which is…

Q: Using the flowchart, identify the part of the human nervous system that is usually associated with…

A: In the realm of neurology, various symptoms and sensations often provide crucial clues about the…

Q: cause flight is metabolically demanding, birds have very efficient systems that help to meet these…

A: The ability to fly is a remarkable capability, but it comes with significant metabolic demands for…

Q: Cricotopus sylvestris is a small two-winged fly that is often seen in swarms near water or marshy…

A: Cell division is the process by which a parent cell divides into two or more daughter cells. It is a…

Q: The diagram shows the ၁ မှတ် action of amylase O part of a starch molecule amylase adać What is the…

A: Amylase is a digestive enzyme that is mostly released by the pancreas and salivary glands, while it…

Q: Tissue type found to accomodate stretching, such as in the simple cuboidal epithelial; kidney…

A: Epithelial tissues are the tissues found on the outer or inner layer of body surfaces or hollow…

Q: The layer of skin has which are helpful to surgeons making incisions and allowing them to heal…

A: Skin is the outer protective, waterproof covering of the body. Skin consists of two layers the…

Q: Which of the following is not an established role for glial cells? O Providing scaffolds that assist…

A: The cells of the nervous system other than neurons which are incapable of generating and…

Q: In one square of a hemacytometer you count 55 cells. What is the approximate concentration of cells…

A: Hemocytometer is a device that is used to calculate the number of blood cells in a given sample. It…

Q: PART 3: LEAF STRUCTURE 1. In what plant structures does photosynthesis occur? Make your description…

A: Special pigments in photosynthetic cells absorb light energy. Different visible light wavelengths…

Q: The health center cultured the throat swab and after doing a gram stain observed the picture to the…

A: To ascertain the true dimensions of the observed organisms, you can utilize the supplied data…

Q: not vattur tots te Anterior view. The

Q: Plant Comparisons Plant Group Vascular Nonvascular Gymnosperms Angiosperms Monocot Dicot Enter a…

A: The plant groups mentioned here include vascular, nonvascular, gymnosperms, angiosperms, monocots,…

Q: Long term use of high-dosage tetracycline causes cellular damage that mimics mitochondrial disease…

A: Tetracyclines are a group of drugs that are employed to control and treat different bacterial…

Q: RAS is a signal transducer that acts as a switch for turning on cell division. Drag the descriptions…

A: Cells communicate with each other through specific chemical signaling pathways that are known as…

Q: A temperature sensitive mutant is isolated where at the non-permissive temperature replication stops…

A: The process by which a cell copies its genetic material is called DNA replication. The unwinding of…

Q: In a species of beetle, the size and color of the wings are controlled by two distinct genes. There…

A: Answer :- Linkage disequilibrium (LD) is a fundamental concept in genetics that measures the…

Q: Prokaryote Cells Indicate if the following statements about prokaryotes are true or false. A. They…

A: Prokaryotes are unicellular creatures that belong to the Archaea and Bacteria domains. They are…

Q: influenced by the proteome in response to the environment. The juvenile clownfish has both male and…

A: Gene encoding characteristics are usually present from the beginning and proteome induced changes…

Q: Is it better for an organism to maximize their direct fitness or their indirect fitness? a. Direct…

A: In evolutionary biology, fitness refers to an individual's reproductive success and ability to pass…

Q: Inheritance terms Refer to the Punnett square below as you fill in the blanks in the following…

A: The phenotype of an organism refers to its visible physical and functional characteristics. These…

Q: Calculate ECI for the following case: Temperature is 20 degree C. [Cl]out = 140 mM, [Cl]in =14 mM.

A: This answer can be calculated by Nernst equation. Nernst potential as calculated by Nernst equation…

Q: Classify the item with the correct region of the nasal cavity. Skin Vibrissae Olfactory receptors…

A: Respiratory system is one of the body systems which is involved in removal of carbon dioxide and…

Q: Transcription in eukaryotes requires which of the following? Choose ALL that apply. the protein…

A: The genes are hereditary units in living organisms. They carry specific functions or…

Q: 2. Which phrase correctly defines net production efficiency? The amount of energy- A. captured from…

A: The sun provides all of the energy required to support life.Producers are the plants that directly…

Q: Role of Homeostasis in Human Physiology: A Review After reading the article, research what disorders…

A: Here are two disorders that result from loss of homeostasis:Type Diabetes Hypertension

Q: A B C D E F G H I Select one: O a. C is more closely related to D than to E O b. A and B are equally…

A: This is a representation of a phylogenetic tree. A phylogenetic tree represents different groups…

Q: Osteogenic stem cells give rise to all of the following cell types EXCEPT: Oosteoclasts O osteocytes…

A: Osteogenic stem cells, also known as osteoprogenitor cells, are a type of stem cell that plays a…

Q: Metabolic syndrome is a genetic disorder with symptoms of hypertension. concentrations, and…

A: Metabolic syndrome is a medical condition characterized by a number of health problems, including…

Q: h. After cytokinesis of meiosis II 4. In cats, blood type A results from an allele A which is…

A: Co-dominance is demonstrated by the ABO blood group system. It is the most common blood group…

Q: In an infected breast tissue, which of the following will not be consistent with the pathway of…

A: The question pertains to the apoptotic pathway in infected breast tissue, specifically focusing on…

Q: Label the diagram to explain how the ncRNA HOTAIR plays a role in gene expression. Nearby histones…

A: A long non-coding RNA (nc RNA) molecule is HOTAIR (HOX Transcript Antisense Intergenic RNA). A type…

Q: what has to happen successfully for evolution by natural selection to take place? a. Mutation b.…

A: In order for species to adapt and better fit their ecological niches, natural selection is a major…

Q: are joints that are immovable, they are composed of and an example would be None of these options…

A: In human anatomy, the concept of joints, or articulations, holds paramount importance. Joints are…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

2. How would you recombinantly purify a human protein from
Digest DNA
Express Protein
DNA Ligation
Agarose Gel
PCR Amplification
Chromatography
a cell extract of mRNA? Organize the following terms.
Generate cDNA
SDS-PAGE/Western
Bacterial Transformation
Blue/White Screening

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Recombinant purification

VIEW

Step 2: Steps

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is inserted in to the polylinker site of pUC18 and then introduced into E. coli cells.. Hindll Sphl Sbfl Pstl BspMI Acci Hincli Sall Xbal BamHI Aval Smal Xmal Acc651 Kpnl Banll Eco53kl Sacl Apol ECORI lacz MCS LacR binding site Plac PUC18 Amp 2686 bps PMB1 ori
Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
Ehat primer sets could be amplify the following DNA sequence? AATACGTCGCATGGggatccttttttatgcatg
Synthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?
you carry out DNA editing using CRISPR whter the editing template DNA has strands labeled with heavy nitrogen 15N. The experiment is carried out in presence ofnormal light isoptope 14 N. The expected distribution of the isotope in the strands in the edited region of the target DNA would be: 1. only one strand is labeled iwth 14 N and the other with 15 N 2. both srrands are labeled with 15 N 3. both strands are labeled with 14 N
Select all that are true about DNA gel electrophoresis O This technique can be used to separate DNA based on the size of the fragment O Since DNA is positively charged it will travel to the negative electrode O After a gel is run, the larger fragments end up being further away from the well The rate at which DNA fragments travel is logarithmically and is inversely proportional to its size
Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )
Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
Which of the following does the enzyme primase synthesize? DNA primer RNA primer Okazaki fragments phosphodiester linkage
5. Consider the following plasmid (size 8000 bp), with restriction sites at the positions indicated: PstI XhoI 7000 8 kb 2000 XhoI Probe 4200 ECORI This plasmid is digested with the enzymes listed below. Indicate how many fragments will be a) generated in each case, and give the sizes of the fragments. PstI XhoI Combination of PstI + XhoI + EcoRI (triple digest) b) Draw the banding pattern you would expect to observe if each of these digestions is loaded into a separate well of an agarose gel, and the fragments separated by electrophoresis. In the first well you load a DNA marker (M) containing fragments with sizes of 1000 bp, 2000 bp, 4000 bp and 8000 bp. This gel is transferred to a membrane in a Southern blot experiment, and hybridised to a c) radioactively labelled 200 bp probe, which anneals to the plasmid DNA at the position indicated on the diagram above. Draw the autoradiographic profile you would expect to observe for the membrane.