Q: DNA extraction, PCR, gel electrophoresis, and DNA sequencing of PCR products. Give a description of…
A: DNA extraction is the procedure of isolating the Deoxyribonucleic acid from biological samples. PCR…
Q: You are interested in amplifying the putative gene encoding the 480-bp protein TMR (Total Memory…
A: We are given with the gene that is needed to be amplified by PCR. The image shows a region of DNA…
Q: Determine the effect (increase, decrease, no effect or cannot be determined) of the stated condition…
A: DNA is Deoxy ribonucleic acid’s and DNA have sugar phosphate as backbone and this sugar phosphate…
Q: A facility says they need 15 μL of a 40 ng/μL solution of plasmid DNA for sequencing. The typical…
A: Appropriate amount of DNA is one the key elements in gene sequencing. Amount of DNA for sequencing…
Q: Why the DNA sequencing alone is often not sufficient to produce a genome assembly of desired…
A: DNA sequencing is basically the process by which the nucleic acid sequence can be determined. the…
Q: The Qiagen DNeasy DNA extraction kit is used to extract DNA from a liver cell line for subsequent…
A: The Qiagen DNeasy DNA extraction kits are designed for rapid purification of total DNA that is…
Q: DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki…
A: The given statement is TRUE
Q: The following sequence of nucleotides is found in a single-stranded DNA template:…
A: The process of formation of mRNA from DNA is called transcription.
Q: CTAB method is usually used for extracting DNA from eukaryotic samples particularly plant samples.…
A: The steps involved in extraction of DNA are: a. The cells are disrupted to expose the DNA within,…
Q: Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing,…
A: Hi! Thank you for your question. We are answering your question on the basic knowledge of the…
Q: Describe the role of dideoxyribonucleotides ingenerating DNA fragments for analysis
A: Sanger developed a method to determine the sequence of deoxyribonucleic acid (DNA) called the Sanger…
Q: In a typical microbiology laboratory, reasons for no bands from a gel of a polymerase chain reaction…
A: Polymerase chain reaction (PCR) is the in-vitro amplification of the DNA sequences. The process…
Q: Terminal-sequencing reads of clone inserts are a routinepart of genome sequencing. How is the…
A: The whole-genome shotgun (WGS) method used for sequencing the DNA from the pool of many fragments by…
Q: Why is it a large undertaking to construct a DNA library?
A: A deoxyribonucleic acid library could be an assortment of cells that carry cloned items of the whole…
Q: Would you choose an exonuclease while producing a recombinant DNA molecule?
A: Exonuclease eliminates nucleotides from the ends of the DNA and thus it can't help in secluding…
Q: Explain the proofreading function of DNA polymerase.
A: Proofreading means correcting the incorrect base pairs by removing and adding correct base pairs.…
Q: Explain the mechanisms on the proofreading of DNA.
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: .How much PCR product (500 bp) should be added to a ligation in which 50 ng of Vector (6.6 kb)…
A: Introduction :- Polymerase chain reaction (PCR) is a widely used method for rapidly producing…
Q: Construct a detail linear restriction map according to the given information in Table 1 below. Table…
A: Total size of DNA= 11 kb EcoRI has one restriction site cutting it into 2 fragments of 2kb and 9kb…
Q: CDNA libraries Select an answer and submit. For keyboard navigation, use the select an answer. a a)…
A: Gene is the primary fundamental unit. These are made up of Deoxyribonucleic acid (DNA). The DNAs…
Q: 30) In the CRISPR system, the targeted DNA sequence is
A: CRISPR stands for clustered, regularly interspaced short palindromic repeats. Engineered CRISPR…
Q: Comprehensively discuss the principle and applications of PCR.
A: The polymerase chain reaction (PCR) is a technique for amplifying DNA sequences in the lab. The…
Q: Explain why DNA ladders are usually included during gel electrophoresis.
A: BASIC INFORMATION GEL ELECTROPHORESIS It is a process in which the DNA fragments are separated…
Q: Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in…
A: Polymerase chain reaction is a method used to make several copies of a specific target DNA.
Q: The major products of proofreading by RNA polymerase are dinucleotides rather than mononucleotides.…
A: Introduction: DNA polymerase holds the ability to proofread the strand synthesized during…
Q: Select all that apply. The Klenow fragment: has primase activity. is an E. coli DNA polymerase…
A: DNA polymerase is an enzyme, which helps in the synthesis of the DNA complementary strand from the…
Q: 7. A 1000 bp EcoRI restriction fragment contains a gene you are interested in. The fragment was…
A:
Q: 7. A 1000 bp EcoRI restriction fragment contains a gene you are interested in. The fragment was…
A: EcoRI is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction enzyme…
Q: Restriction enzymes and DNA ligase are key components when preparing cloning vectors. True or False.
A: Main components for preparation of cloning vector are : Origin of replication Marker gene…
Q: Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing,…
A: Although the techniques used are same, there is difference in the chemicals used by ThermoFischer.…
Q: The concentration of your RNA solution is 1500 ng/μl. How much RNA solution do you need to use when…
A: The concentration of RNA in solution can be determined by measuring absorbance at 360 nm.
Q: "Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?
A: Introduction The cDNA library is a collection of mRNA segments cloned into independent vector…
Q: The optimal design of primers is critical to the effective amplification of DNA sequences. i)…
A: INTRODUCTION Polymerase chain reaction (PCR) is a method widely wont to rapidly make millions to…
Q: Recall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP…
A: In genetics, floxing refers to sandwiching the DNA sequence between two lox P sites. Lox P or…
Q: When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were…
A: Answer :: If the dCTP was not present, the polymerization would come to a standstill, resulting…
Q: The current state-of-the-art in forensic DNA profiling involves the PCR-amplification and analysis…
A: PCR is a process in which millions of copies of a specific sequence of DNA can be made in a matter…
Q: The exponential nature of PCR allows spectacular increases in the abundance of a DNA sequence being…
A: DNA is the chemical name for the molecule that carries genetic instructions in all living things.
Q: Briefly describe what happens during each of the phases of PCR (denaturation, annealing, and…
A: The “polymerase chain reaction” (PCR) is a technique in which millions of copies of the target DNA…
Q: Aside from gel electrophoresis Give another method to quantify DNA. Explain the concept behind this…
A: DNA quantification is a type of quantification of nucleic acids that is used for the determination…
Q: Briefly present experimental and practical benefits of using PCR in DNA cloning process. Give some…
A: The DNA Cloning is the production of a large number of identical DNA molecules from a single…
Q: The exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being…
A: Polymerase chain reaction, or PCR, is a technique to make many copies of a specific DNA region in…
Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…
A: DNA isolation is a process of isolation of DNA from biological sample like body fluid, tissue, etc.…
Q: Discuss the importance of adding radioactively labeled molecules during 16S ribosomal RNA sequencing…
A: The bacterial isolates can be identified accurately by the 16S ribosomal ribonucleic acid (rRNA). It…
Q: What is the meaning of proofreading activity ? O A. The polymerase checks for the correct…
A: DNA means deoxyribo nucleic acids. DNA act as genetic material in most organisms present on earth.…
Q: Applications of PCR Consider this restriction enzyme (RE) named Hindlll 5...A AGCTT... 31 3...…
A: Hi ! Since you have posted multiple questions and haven't mentioned which to answer, we shall answer…
Q: Describe the proofreading activity of DNA polymerase.
A: Although DNA polymerase is a very effective enzyme, it can potentially introduce an erroneous…
Q: A student is running gels to sequence a DNA fragment as below. In addition to running four…
A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…
1)explain why it is far less important for RNA
Polymerase to have proofreading activity than it is for DNA polymerase.
60-word limit
Step by step
Solved in 2 steps
- 2) explain why it is far less important for Primase to have proofreading activity than it is for DNA polymerase. 60-word limitThe enzymatic activity necessary for proofreading is: O reverse transcription O ligase O endonuclease O exonuclease O polymeraseWhy DNA melting is required in PCR? Briefly explain how PCR can be used to detect DNA mutation.
- Clone number in this case is number 196 as shown in the images. What is the exact length of the segment of human DNA that has been inserted into the plasmid? *report the entire length of the insert, not just the sequences matching the ends and labels of wells isn't needed for answer*Briefly explain the rationales of adding chemicals that can affect DNA stability in a polymerase chain reaction (PCR). Why DNA melting is required in PCR? Briefly explain how PCR can be used to detect DNA mutation.b) Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading
- Distinguish DNA-dependent DNA polymerases, DNA-dependent RNA polymerases, RNA-dependent RNA polymerases, and RNAdependent DNA polymerases in terms of their templates, products synthesized, and proofreading activity, as discussed in this and previous sectionsList the steps in the polymerase chain reaction; discuss one disadvantage to this techniquePCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCGȚAGCTATATGCTATCGTGACGTATCGGCGCATTAAȚCGGGATCGAT 3 50 3' TGGCÁTCGATATACOATAGCACTOCATAGCCGCGTAATTÀGCCCTAGCTÀ 5' 5' AGCTÇGCTAGCAGGAGAGAȚATCGÇTCATAGCTCCGATCGATGCCGCTAA 3 3' TCGAGCG ATCGTCCTCTCTÁTAGCGAGTATCGAGÓCTAGCTACGGCGATİ 5' 100 5' TATAGCTCTÇTGCGGATATÇGCATATACCẠ AGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACOCCTATAGCGTATATGGTTCCGGGATGČATACATCGAŤ 5' 5 TGCGTATATÇGGAGAGTCCTGGATATGGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCÁTATAGCCTCICAGGÁCCTATACCTCGAACTGACGTCTCTCGAGCT 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 3. ATACGCGAATCCGGCATATACGAACCCCTÍTCGAGATACATACGATACAC 5' 250 5' TGCATGTGCTATGCAACGTTCOGATTGCGȚAGCAGTAATAGCGCCGATTG 3 300 3'…
- Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACWhat advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.TRUE OR FALSE. a) The Sanger method of DNA sequencing follows the principle of complementarity just like in the replication process. b) Supercoiling whether positive or negative, can be experienced in the replication or transcription process.
