Please answer asap and in short only first question 13. Why does mega dosing of a single mineral inhibit the absorption of other minerals?14. Other than excess sodium, what other dietary factors are associated withhypertension?4. What factors effect an individuals water needs?10. Which two conditions would cause fatal dehydration? Why does this happen?11. Chronic dehydration plays a role in the development of which conditions?8. What are the 4 stimuli for thirst?9. What is a diuretic? Give examples.

Minerals: Minerals are the essential substances that are needed in our body in order to develop and…

Answered: 13. Why does mega dosing of a single…

Science

Biology

13. Why does mega dosing of a single mineral inhibit the absorption of other minerals?

Ebk:Nutrition & Diet Therapy

10th Edition

ISBN:9780357391747

Author:DEBRUYNE

Publisher:DEBRUYNE

Chapter13: Nutrition Through The Life Span: Later Adulthood

Section: Chapter Questions

Problem 7SC

See similar textbooks

Related questions

Q: The is the foundation of a medical term The comes at the end of a medical term The is attached to…

Q: Often, the physical characteristics of genetically identical twins become increasingly different as…

A: Please follow step 2 for detailed explanation.

Q: Distinguish between “fundamentalcauses” and “proximate risk factors” ascauses of disease.

A: Fundamental factors:- Fundamental factors are the factors which can be attributed as the main…

Q: In Mendel’s terminology, a “true-breeding” variety of a particular plant: a. Has a homozygous…

A: Introduction Breeding is the sexual reproduction of animals or plants that results in progeny. It…

Q: Which of the following events that may occur during meiosis and fertilization will increase the…

A: As we know that in eukaryotes two types of cell division take place : Mitosis : A parent cell…

Q: 4. Cholera is a disease caused by bacteria that make cholera toxin. In the presence of this toxin,…

A: Mode of action of cholera toxin that leads to diarrhea:-

Q: 8. Renal clearance of glucose in a normal healthy person is A. O ml/min B. 40 ml/min C. 90 ml/min D.…

A: C.90ml/min

Q: 3. Which of the following hormones increases pancreatic juice (including pancreatic enzymes and…

A: Pancreatic juice is a liquid secreted by the pancreas that contains digestive enzymes such as…

Q: Based on his phenotype muggle, with the information provided, can we tell what Dudleys second allele…

A: Inheritance or heredity is passing-on one trait from the parents to the progeny by either asexual or…

Q: Invasion step of metastasis is a complex process that involves epithelial cells transitioning into…

A: Epithelial cells are specialised cells that coat the insides of spaces, organs, and blood vessels.…

Q: When 1.6 million year old Nariokotome/Turkana skeleton was recovered near Lake Turkana in Kenya.…

A: This shows that the discovered skeleton was a preadolescent.

Q: Which of the following is a result of agriculture? Sedentarism Nomadism Egalitarianism Foraging

A: To determine: To determine the result of agriculture from the given options

Q: 5. Which of the following responses is/are regulated by positive feedback mechanism?

A: This question is based on positive or negative feedback mechanisms.

Q: What are tyrosine kinase and GPCR? Give example of one pathology that can occur in…

A: Tyrosine kinase and GPCR dysregulation and rescue :-

Q: a. Carbon Cycle i. Producers ii. Consumers iii. Decomposers iv. Methanogenesis

A: Carbon cycle is the biogeochemical cycle by which carbon is exchanged among biosphere, pedosphere,…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Part C Suppose that you discover cels containing a mutation in a second protein and learn that this…

A: The ability to degrade proteins is an essential function of all eukaryotic cells. The two main…

Q: 1. Starch can be completely digested and become monosaccharides in the presence of A. salivary…

A: Essentially all the carbohydrates in the food are absorbed in the form of monosaccharides. Only a…

Q: 2.) One experimental tool used in the biological research and in clinical settings is called…

A: FACS/ Fluorescence-activated cell sorting (FACS) is a specialized type of flow cytometry, which…

Q: Explain why populations change over time.

A: Population change is simply defined as the change in the number of people in a specific area over…

Q: What regions of the skeleton may be most useful for determining the sex of the individual from the…

A: Ans is- PelvisIn

Q: The arteries that pass through the heart muscle are necessary for delivering enough oxygenated blood…

A: The pressure inside the vessels is generated by the blood volume. The pressure outside the vessel is…

Q: Describe the hindlimb function / specialization for a rabbit, pigeon, turtle, and toad.

A: Introduction:- The bones of the hind limb include the femur, the meniscus ligament, the ankle and…

Q: What is the problem in the article "Stopping pandemics before they start: Lessons learned from…

A: Introduction Pandemics:- It is the worldwide spread of a new disease, it is an outbreak of disease…

Q: What is the major function of lysosomes? They: A. package proteins B. detoxify toxic substances C.…

A: Introduction -Lysosomes are membrane-enclosed organelles that contain a variety of enzymes that can…

Q: In ethology, what are the cost and benefits of Group living?

A: Answer

Q: 3. Although rabbits cannot break cellulose down into simple sugars, the bacteria that live in their…

A: Cellulose is a polysaccharide that consists of several units of beta D glucose units joined…

Q: What is the article "Stopping pandemics before they start: Lessons learned from SARS-CoV-2" about?

A: Introduction SARS-CoV-2 is a member of a large family of viruses called coronaviruses, This virus…

Q: Draw how the signals are traveled through the nervous system

A: Nervous tissue is the tissue that allows the propagation of electrochemical signals as nerve…

Q: Choose from the following list the systems involved in assisting protein folding in vivo (more than…

A: Protein folding is a process by which linear polypeptide chains fold into its functional…

Q: RNAi is a mechanism for regulating gene expression. It utilizes small microRNAs (miRNAs) transcribed…

A: miRNAs can do which of the following?

Q: ACTIVITY 12 - CARBOHYDRATES As you watch the videos, take notes about what you are learning about…

A: Introduction Sugar molecules are carbohydrate molecules. Carbohydrates are one of three main…

Q: MEDICAL TERMMAIN ENTRY (pronunciation) MEANING (definition) |1. glycemia |2. hypothalamus 3.…

A: Anatomy is a branch of biology that deals with identifying and characterization of living things'…

Q: How does intermittent fasting relate to carbohydrates, lipids, proteins, nucleic acids, enzymes etc.…

A: Intermittent fasting (IF) is a term used to describe a variety of eating patterns in which no or few…

Q: oncept Mapping: Fill-in the concept map of egg release (start with the ovary). Use the following…

A: The egg is collected by finger-like extensions on the end of the fallopian tubes as it is discharged…

Q: What is the major function of lysosomes? They: A. package proteins B. detoxify toxic substances C.…

A: Lysosomes serve as the cell's digestive system, degrading material brought in from outside the cell…

Q: What are the 6 characteristics of inflammation? Which of these 6 characteristics are signs and which…

A: Introduction:- Inflammation is a reaction to harm to living tissues. The inflammatory response is a…

Q: How does capillary electrophoresis differ from gel electrophoresis? a) The capillary system can…

A: Gel electrophoresis is done in a vertical or horizontal plane with a polymeric matrix of…

Q: chymotrypsin

A: Chymotrpsin: It is a digestive enzyme which breaks down polypeptides. It consists of a catalytic…

Q: Write T (True) or F (False) for the following statements.

A: Hi! Thank you for the question. Since you have asked multiple questions, we will answer only the…

Q: Incorrect Question 6 Which conditions would NOT lead to good preservation of a dead hominin…

A: Ans is-- Dying in an open grassland that is seasonally dry or wet.

Q: Whether the given statement "Lateral roots form at nodes on roots" is true or false.

A: The roots of vascular plants are modified organs that provide anchoring for the plant and take in…

Q: Sickle cell 1). how many people does it affect? 2) Is it genetic and if so what chromosome is the…

A: Sickle cell disorder :-

Q: indicators, key used for/ determines reagents, or key positive result ingredients 1. crystal violet…

A: According to the guidelines, we are supposed to answer only three sub-parts. Kindly repost the…

Q: What is eusociality and list down some characteristics of a eusocial system?

A: There are levels of society defined in the text, the highest being the Eusociality.

Q: Moving from 3’ to 5’ along the sugar phosphate backbone of a single strand of nucleic acid, the…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: indicators, key used for/ determines reagents, or key positive result ingredients |1. crystal violet…

A: According to the guidelines, we are supposed to answer only three subparts. Kindly repost the…

Q: Explain the reason why the roots lack the protective covering like the plant surface which has a…

A: Roots are the parts of vascular plants that are normally found below ground. During seed…

Q: Define the followir Endocrinologist Нуpothyroidism Нурopituitarism

A: The endocrine system is a messenger framework containing feedback circles of the hormones delivered…

Q: Dynamin-mediated membrane fission at the plasma membrane is topologically equivalent to vesicle…

A: Answer :- Option (C) is correct. -homotypic vesicle fusion.

Question

Please answer asap and in short only first question

13. Why does mega dosing of a single mineral inhibit the absorption of other minerals?
14. Other than excess sodium, what other dietary factors are associated with
hypertension?
4. What factors effect an individuals water needs?
10. Which two conditions would cause fatal dehydration? Why does this happen?
11. Chronic dehydration plays a role in the development of which conditions?
8. What are the 4 stimuli for thirst?
9. What is a diuretic? Give examples.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

2) how do our nephrons deal with Coke. a act. you must mention each part of the nephron as any filtration, reabsorption and for Secretion that takes place as well B) If over consuming coke how will it effect our blood pressure and what hormones are realesed to return your body to homeostasis. are the hormones released from and where they Where
1. After driving from sea level to a trail head in the high Cordilleras, you get out of your car and feel dizzy. What do you suppose is causing your dizziness? How is this beneficial and how is this detrimental? What may eventually happen that would counteract the cause of the dizziness? 2. Two men are diagnosed with diabetes insipidus. One didn’t have the disorder until he suffered a stroke. The other had a withstood the condition all his life, and it had never responded to exogenous ADH despite the presence of normal ADH receptors. What might be the cause of the diabetes insipidus in the two men? 3. Which surgery do you think would have the most profound effect on digestion: (a) removal of the stomach (gastrectomy); (b) removal of the pancreas (pancreatectomy); or (c) removal of the gallbladder (cholecystectomy)? Explain your reasoning.
1. After driving from sea level to a trail head in the high Cordilleras, you get out of your car and feel dizzy. What do you suppose is causing your dizziness? How is this beneficial and how is this detrimental? What may eventually happen that would counteract the cause of the dizziness ? 2. Two men are diagnosed with diabetes insipidus. One didn’t have the disorder until he suffered a stroke. The other had a withstood the condition all his life, and it had never responded to exogenous ADH despite the presence of normal ADH receptors. What might be the cause of the diabetes insipidus in the two men?
Which of the following statements are true? Multiple Choice. Signs of dehydration in older adults include weakness, constipation, and mental confusion. All of these choices are correct. The body's water content decreases with advancing age. Risk of urinary incontinence increases as a person ages.
1. On a hot day a tourist in the wilderness could not find a source of drinking water for a long time. Finally, he reached a village and quenched his thirst. How will his water and salt balance change after that? For answer: a) name the hormones that regulate the water and salt balance; b) draw a chart explaining the occurrence of thirst; c) using the chart, compare the state of the tourist's water and salt metabolism before he drank water and after. Id abil Digestiu
1 and 2 e. 72. About one million microscopic structures are present in the kidney, which serve as the latter's structural and functional units. What are these units of the kidney known as? 75. The reabsorption of which component of the filtrate contributes most to the decrease in volume as it becomes urine? a. Nephrons b. Villi a. Glucose Rugae b. Amino acids c. d. Nerves c. Water Capillarv network d. Glycerol е. e. Sodium ions 73. Use the following additional information to answer the next question. Part of the nephron Mood Mood en - npilary boed etums to heart The numbers 1, 2, 3, and 4 represent four processes that are crucial for urine formation. At which step is a plasma-like filtrate of blood is created? a. 1 b. 2 3 d. 4 1 and 2 c. e. 74. Use the following information to answer the next question. Structure of nephron 3 4 In the above diagram, the part of the nephron that filters the blood to create a filtrate is numbered a. 1 b. 2 C. 3 d. 4
1. what habit, in addition to good nutrition, contribute to making a person healthy? 2. name causes and consequences of water depletion.
74- the maintenance fluid requirement for pts under 10kg 75- Minimum urine output for all ages is 76- Immature 77- Risk factor for dehydration - body fluid loss in excess of fluid 78- Risk factor for dehydration is that it is often associated with 79- Risk factor: Dehydration is to 80-Sodium is normally between function contributes to fluid and electrolyte risk factor imbalance Three classifications of dehydration are
5. Which of the following categories is more susceptible to having low bodily water levels? 1. Elderly and infant 2. Infant and obese 3. Obese and elderly 4. Infant and adolescent
1. Urine glucose is usually negative. Using a table of reference values for blood and urine tests, look up normal values for blood pH, blood glucose, blood ketone bodies, and urine pH, and identify whether each test result is normal or abnormal. 2. A “fruity acetone combined with alcohol” smell was detected in Mr. Boulard’s breath, and in his urine. Which substance is producing the “fruity acetone” smell? 3. Where in the body are ketone bodies produced? What energy source does the body use to produce these substances? 4. The production of large amounts of ketone bodies is often seen when glucose is not readily available as an energy source (e.g., in starvation). In Mr. Boulard’s case, large amounts of glucose are in the blood. Explain why his body is producing ketones in the presence of suchlarge amounts of glucose. 5. Explain how the pH of Mr. Boulard’s blood and urine is related to the ketone bodies measured in each of these fluids.
4 Red Bone 1. What can cause low blood 0,? Marrow 2. Olympic athletes often train at high elevation. How would high elevation affect the following? EPO levels Hematocrit O, carrying capacity 3. What condition may develop in people with kidney disease? Why?
1. Discuss the significance of the following pathological constituents when present in urine: a. ketone bodiesb. glucosec. pentosed. Albumin e. bile1. How is uric acid formed? 2. What is the smell of urine after an hour?3. What the chemical equation in the formation of indican?