1. You are given with the DNA sequence in the leading strand template. See item number 1 in worksheet row A. Supply the information asked for in the succeeding rows: row B: supply the bases in the complementary strand. row C: Assuming that the sequence in the 1st row is the template for transcription, supply the bases of t MRNA transcript. Label the 5' and 3' ends. row D: Identify the amino acids that comprise the polypeptide chain as the ribosome would have identifi them. Just merge cells before you label the amino acids based on the codes. Label the 5' and 3' ends. 2. Complete the necessary information. Answer the guide questions. A. Replication, Transcription and Translation. Use BLUE FONT COLOR for all answers. 1. This is the DNA sequence in the leading strand template. Follow the instructions given on page 75 of module 3. 5' T T T. G T. G A A A C A 3' C

1. You are given with the DNA sequence in the leading strand template. See item number 1 in worksheet row A. Supply the information asked for in the succeeding rows: row B: supply the bases in the complementary strand. row C: Assuming that the sequence in the 1st row is the template for transcription, supply the bases of t MRNA transcript. Label the 5' and 3' ends. row D: Identify the amino acids that comprise the polypeptide chain as the ribosome would have identifi them. Just merge cells before you label the amino acids based on the codes. Label the 5' and 3' ends. 2. Complete the necessary information. Answer the guide questions. A. Replication, Transcription and Translation. Use BLUE FONT COLOR for all answers. 1. This is the DNA sequence in the leading strand template. Follow the instructions given on page 75 of module 3. 5' T T T. G T. G A A A C A 3' C

Name: 1. You are given with the DNA sequence in the leading strand template
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. You are given with the DNA sequence in the leading strand template. See item number 1 in worksheet,row A. Supply the information asked for in the succeeding rows:row B: supply the bases in the complementary strand.row C: Assuming that the sequenc

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference 5’ CTATATTTATGTGCTATATCCAGGACTGCCCCTAGGAAATAAAAAA…AAAAAAA 3’3’ GATATAAATACACGATATAGGTCCTGACGGGGATCCTTTATTTTTT…TTTTTTT 5’
Complete the table below 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of…
Consult the DNA below. Only one strand is shown (the complementary strand is not shown). What 2 aspects can you observe in this animal DNA that indicates that it is the regulatory part of a eukaryotic transcription unit? (The spaces are added to make the sequence easier to read). AGAGGGCGGT CCGTATCGGC CAATCTGCTC ACAGGGCGGA TTCACACGTT GTTATATAAA TGACTGGGCG TACCCCAGGG TTCGAGTATT CTATCGTATG GTGCACCTGA CT..................
The diagram below depicts an active transcription bubble after a short period of RNA synthesis during the transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram. Motivate your answers. (i) the template and the non-template strands; (ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand; (iii) the location of a possible promotor sequence; (iv) the location of a possible Shine-Dalgarno sequence; (v) the specific area of activity of a RNA polymerase.
The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'
Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
From standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.
Remember: for every DNA and RNA sequence you determine in this assignment, do not forget to indicate the 5' and 3' ends The following is the DNA template strand for a specific gene. The sequence does not include a promoter region or the terminator region. 3' | A|C|A| |GT|G|T|ATAA A A CC G|CGIIT TCTCC|AG|CT|T|G|C|G|G|G| G|G|A|T|T|G|C|G|C|A |A G CCAAA|G|ACAA|TAGG|ATACGTA |ATCTTT| 5' 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the MRNA primary transcript sequence 5' GGG AUG UCA CÁC AUA UUU 1 2 3 4 5 6
Errors are occasionally made during the process of transcription. Explain why these errors do not always result in an incorrect sequence of amino acids. Describe at least two examples to illustrate your answer.
a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?
b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand C DNA strand T G A MRNA codon C|A U TRNA anticodon G A polypeptide TRP
17. Complete the following Central Dogma Grid Puzzles: First determine which DNA strand is the template (look at provided nucleotides). Label template and coding/sense (non-template) strand in first column. In the second column, label the 5' and 3' ends of DNA and RNA sequences and the amino (N) and carboxyl (C) ends of the polypeptide. The last four columns represent transcriptional and translational alignments (reading frame). This is from within a coding region so you don't have to find a start codon. Fill in all nucleotides and amino acids using the mRNA code table on the last page. a. On this first grid, assume that the DNA and RNA templates are read left to right. DNA strand C DNA strand G mRNA codon A U TRNA anticodon A polypeptide TRP