A biochemist was able to sequence a DNA found in a human sample from humans who were first believed to settle in the Philippines. The sequence was identfied to be 3'-TACTATTTGCGAGTACGCGATAT TGCATC-5'. 1. What is the complementary strand of sequenced DNA? 2. What is the transcription product of this DNA? 3. What is the sequence of the polypeptide that will be produced from this gene?
Q: For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show…
A: Polymerase (PCR) chain reaction is a process in which small DNA fragments are amplified into a…
Q: A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-…
A: Restriction endonuclease is an enzyme which cleaves DNA into fragments at specific location sites…
Q: Below is a sequence of DNA.…
A: Introduction :- Adenine (A), thymine (T), cytosine (C), and guanine (G) are four nucleic acid bases…
Q: Which 2 primers will copy the entire sequence of DNA: 5'…
A: Primer is a short nucleotide sequence which is required to initiate DNA replication . To the primers…
Q: What is the role of alcohol in extracting DNA? 1.DNA is a polar molecule with an overall negative…
A: DNA extraction is a process involve disruption and lysis of the cell followed by the removal of…
Q: To test whether you understand the processes involved in the Central Dogma of Molecular…
A: The synthesis of RNA from the DNA is known as transcription and they synthesis of protein from the…
Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…
A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…
Q: Why must the lagging strand of DNA be replicated in short pieces a. Because of limited space b. To…
A: The replication of the DNA takes place in a semiconservative pattern in which the DNA duplex unwinds…
Q: 1. Below is a partial sequence of a guide RNA. The underlined section of the RNA is designed to…
A:
Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In…
A: The first step in gene expression is the synthesis of an RNA molecule copied from the segment of DNA…
Q: When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed…
A: It is related to molecular biology in which we use restriction enzymes an important tool for
Q: You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To…
A: In PCR, forward and reverse primers are to be added. PCR involves denaturation, annealing and…
Q: 5' guanine cap 5' AUGCCGAUGCCUCCUAUCAGAUAAAAUAAA poly A tail AAAA 3' During DNA replication, a…
A: The mutation is the sudden and abrupt change in the structure and function of the chromosomes.
Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…
A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of…
Q: How often, on average, would you expect a type II restriction endonuclease to cut a DNA molecule if…
A: Restriction endonucleases are enzymes produced by bacteria that cut the DNA at a specific site known…
Q: Using the DNA strand shown here as a template, what will be the sequence of the RNA transcript? 5'…
A: A template is the strand that attach to the complementary strand via DNA polymerase and RNA…
Q: The partial sequence of one strand of a double-stranded DNA molecule is…
A: Restriction endonucleases are the enzymes used in genetic engineering or DNA cloning in which…
Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write…
A: The coding strand is complementary to the template strand. The template strand is the DNA sequence…
Q: The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A…
A: DNA double helix is formed by the hydrogen bonds formed between the base pairs. Adenines forms two…
Q: Which of the following pairs of sequences might be found at the ends of an insertion sequence? a.…
A: Insertion sequence (IS) is defined as a short sequence of DNA acting as a transposon (jumping gene…
Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…
A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Add an A before codon 3 or delete the middle base in…
A: A frameshift mutation occurs in the DNA sequence due to either addition or deletion of DNA bases…
Q: A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced.…
A: An overlapping gene fragment is a gene whose nucleotide sequence partially overlaps with that of…
Q: 17. You are presented with the following DNA molecule: 5 ATGCGATTATAA 3' 3' TACGCTA ATATT5' A. Write…
A: Given: A DNA Molecule: 5' A T G C G A T T A T A A 3' 3' T A C G C T A A T A T T 5' DNA =>…
Q: Below is a small stretch of DNA in the middle of a gene. What amino acid sequence would be encoded…
A: Amino acids are the organic compounds that contain amino group and carboxyl group functional groups…
Q: Dideoxysequencing relies on which one of the following choices: A):Random stopping of one of many…
A: Introduction :- Dideoxysequencing is used in sanger sequencing. Sanger sequencing is a DNA…
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…
Q: Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the…
A: Given: Original DNA template: 3' - ACGGTCAATTTGCTG - 5'
Q: You want to examine genetic variation in your gene promoter. You sequence DNA from several…
A: Single nucleotide polymorphism; it is a type of genetic variation which can occur throughout a…
Q: Below are several DNA sequences that are mutated compared with the wild-type sequence. Each is a…
A: Note - Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: ’. Envision that each is a section of a DNA molecule that has separated in preparation for…
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…
Q: To test whether you understand the processes involved in the Central Dogma of Molecular Genetics,…
A: Central Dogma of Molecular Genetics is the formation of DNA to RNA to Proteins. Thus the genetic…
Q: If the DNA duplex for the beta chain of haemoglobin represented by the sequence…
A: Given the template strand in transcription unit is 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' If the…
Q: These sequences are obtained as part of a human genome sequencing project using a library of 150 kb…
A: Contigs are the overlapping sequences present on DNA fragments. Each set of contigs is counted as…
Q: Which of the sequences below would serve as a PCR primer that would bind this DNA strand: 5'-…
A: PCR is polymerase chain reaction. It is a method of DNA amplification developed by Kerry Mullis.…
Q: he enzymes BamH I and Bal II recognise different sequences but leave the same sticky ends: BamH…
A: An enzyme that recognizes a specific sequence on the DNA strand and cuts the DNA into fragments is…
Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC
A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…
Q: Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The…
A: Primers are short sequences of single stranded polymer that mark each ends of the target sequence. 2…
Q: If the GAATTC palindrome repeats are randomly found along the DNA strand, then what can you say…
A: *If the GAATTC palindrome repeats found along the DNA strand then some sizes of the fragments that…
Q: ollowing base removal, DNA polymerase can add nucleotides in the 5'-to-3' direction. Is that true…
A: DNA polymerase is the enzyme used for the replication of DNA. The polymerase uses the template DNA…
Q: What will be the MRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…
A: The template strand is the DNA strand from which mRNA is made. The non-template, or coding, strand…
Q: Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given…
A: DNA strand for deoxyribose nucleic acid. It is the genetic material present in the cell.
Q: Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence.…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: The sequence shown below is the 5' to 3' strand of a dsDNA template. What are the sequences of the…
A: So, for choosing the primers for PCR, following requirements must be fulfilled :- 1. It should be…
Q: 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU…
A: DNA replication is a proces by which molecule of DNA is duplicated. DNA replication is necessary to…
Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…
A: Blood is a body fluid that carries necessary nutrients and oxygen to the cells and transports…
Q: A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of…
A: A mutation is an abnormal change in DNA sequences that alters the protein product and is one of the…
Q: How often, on average, would you expect a restriction endonuclease to cut a DNA molecule if the…
A: Restriction endonucleases are enzymes that function like molecular scissors. They cut the…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Step by step
Solved in 2 steps
- 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…In relation to central dogma of molecular biology answer the following questions: The following segment of DNA is part of the transcription unit of a gene. You know already that RNA polymerase moves in a specific direction along this piece of DNA to convert one of the DNA strands into a single strand RNA transcript so that this entire region of DNA is made into RNA. 5′-GGCATGGCAATATTGTAGTA-3′ 3′-CCGTACCGTTATAACATCAT-5′ Given this information, a student claims that the RNA produced from this DNA is: 3′-GGCATGGCAATATTGTAGTA-5′ Give two reasons why this answer is incorrect.
- 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
- The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.Design primers that will amplify the following region of DNA (assume this is one strand from a double stranded region of DNA). The primers should be 15 bases in length. Indicate the 5' and 3' ends of the primers. 5' GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3'Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA?
- EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3A certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center AccessibilityRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?