Q: cells in the thyroid gland secrete calcitonin which -------calcium concentration decrease increase O…
A: Hormones are chemicals that essentially function as messengers of the body. These chemicals are…
Q: Create a table comprising example and features from Domain to common name. Create 1 table for each…
A: Taxonomy is the branch of science that deals with the name, description, and classification of all…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A:
Q: What is the specific molecule recognized in our ELISA to measure phospholipase C activity? How is it…
A: Snadwisch ELISA method can be to measure phospholipase c activity can detect the level of PLCG2…
Q: 1. Along the coast of Vancouver Island in British Columbia, Canada consists of intertidal zones…
A: Introduction The term "population" usually refers to the number of people living in a specific…
Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…
A: The polar bear is a hyper-carnivorous bear whose native range lies within the Arctic Circle,…
Q: How does F1 Plant help farmers? Give atleast 5
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: How are antibodies to Salmonella H antigen produced? A) antibodies to H antigen are isolated from…
A: The antibodies are produced by the B cells of the vertebrate body. The B cells are present in the…
Q: 2. A nursing mother who has an alcoholic drink secretes alcohol into her milk for two to three hours…
A: Alchohol consumption leads to decrease in hormone production.
Q: why doesn't nalidixic acid affect human cells
A: Quinolones are one of the most commonly prescribed classes of antibacterials in the world and are…
Q: How could you prove that the Tn5 insertion was in the lac operon?
A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…
Q: 1. Which of the ff is NOT a form of asexual reproduction? A. Budding B. Fission C. Fragmentation D.…
A: Introduction :- In biology, budding is a type of asexual reproduction in which a new individual…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…
Q: abel the muscles on the dorsal and ventral sides of the frog. 1 2 10 3 11 12 13 14 15 8 16
A: Frog muscles: In frogs different types of muscles can be found that help the frog in performing…
Q: All of the following are benefits of breast feeding EX a) The baby will receive complex…
A: In infants below 6 months of age, it's advised that breastfeeding is to be followed. Breastfeeding…
Q: n the grouping of cnidarians and ctenophorans in a single phylum before? What were the reasons why…
A: 2. Cnidarians and Ctenophorans are multicellular animals. Both have tissue level of organisation and…
Q: ANSWER THESE QUESTION; Click Edit DNA and make a substitution mutation that changes the first base…
A: Original sequence- ATG CCA GGC GGC GAG AGC TTG CTA ATT GGC TTA TAG Edited sequence- changes the…
Q: 1. Name the receptor indicated by the arrow labeled A. 2. What specific layer of the skin is…
A: 1. Meissner's corpuscle They contain a cutaneous nerve ending responsible for transmission of…
Q: define both selective and enrichment media as they may be used in clinical microbiology
A: Media in microbiology or also known as bacterial culture media. It is a growth medium used to grow…
Q: 1. What is the probability that one of the offspring will have the genotype DdEeFfggHHli? 2. What is…
A:
Q: QUESTIUN 12 Consider the arrangement of the following four normal chromosomes from some hypothetical…
A: The centromere is involved in an inversion of a chromosomal fragment, and splits happen on both arms…
Q: Some substitution mutation result in a malfunctioning protein but others do not. Why is this?
A:
Q: What would be the working stock concentration (in molarity) if you diluted 250 uL of a stock…
A: Molarity is defined as the number of moles dissolves in 1000 ml of the solution.
Q: The intracellular matrix differs from the extracellular matrix in that the latter is located A…
A: Q. The intracellular matrix differs from the extracellular matrix in that the latter is located A…
Q: OB. metaphase
A:
Q: Complete the attached table representing structural characteristics of A, B and Z DNA duplex. A form…
A: DNA can exist in several forms .There are three major forms of DNA are A-DNA, B-DNA and Z-DNA. The…
Q: What are some changes in the brain that occur in someone with major depression? Describe both…
A: In several cases, the person under depression found to have shrinked brain. The gray matter volume…
Q: In the fruit fly, dumpy wings (d) and purple eyes (p) are encoded by mutant alleles that are…
A: The two genes are involved in this case. The wings and eye encoding genes are involved here. The…
Q: 2. Why do we use samples in the collection of data?
A: Introduction Scientific data:- It is defined as information collected using particular methods for a…
Q: O Ferquency O haematuria O oliguria
A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…
Q: What are the characteristics common to all arthropods? List all of them.
A: Invertebrates are the organism belonging to animal kingdom which do not possess backbone . Such…
Q: In a eukaryotic cell, the majority of the organelles are located in the: cell wall O coelom…
A: Eukaryotes are cells that are complex in structure and function As they have the membrane bound…
Q: Which of the following methods should NOT be used to thaw frozen meats? a) refrigerator thawing b)…
A: Thawing is the process of taking a frozen product from frozen to a temperature (usually above 0°C)…
Q: 1.Compare the structures of ATP to these nucleic acids: cAMP, dinucleotides, RNA, DNA. Your…
A: Nucleic acids include DNA and RNA. The DNA and RNA stand for deoxyribonucleic acid and ribonucleic…
Q: 4. Describe the process of alternation of generations using any plant phylum as an example. In your…
A: Introduction :- In plants and algae, the most common type of life cycle is generational alternation.…
Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…
A:
Q: Examine the family pedigree. What is the probability that their next child will have dry air wax?…
A: Pedigree Pedigree is a chart or diagram that show the occurrence and appearance of any gene of…
Q: Rapidly dividing cells such as bone marrow, skin, intestinal mucosa, and cancer cells need DNA…
A: Cancer is a disease defined by the uncontrolled development of a group of abnormal cells that can…
Q: For billions of years, the only bright objects in the night sky were stars or the moon. Night-flying…
A: Moths are nocturnal organisms. They are active during the night to escape from predators. They use…
Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…
A: Advantage Proof reading ability of DNA polymerase reads the error added codes in DNA and correct…
Q: Pyruvate from glycolysis is oxidized by ATP. in the mitochondrial matrix. a. b. to release water. C.…
A: Aerobic respiration :- it is the process of cellular respiration that takes place in presence of…
Q: Discuss the principles and applications of Matrix-Assisted Laser Desorption/Ionization…
A: Technology is utilized in science, while science is used in technology. Both are vital to our…
Q: Cancer is classified with the type 1 of DM True False
A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…
Q: Which of the following examples DOES NOT involve negative feedback regulation? Regulation of…
A: Introduction The tendency to retain a generally constant internal condition, amid alterations in the…
Q: Describe the proximity in time, similarity in timbre, pitch and good continuation? How are these…
A: Sound is defined as the vibrations that travel through the air or another type of medium as an…
Q: If a phage is undergoing lytic growth, which protein is bound to the operator region? O Both Lambda…
A: INTRODUCTION Lytic stage of phage This is the reproductive stage of bacteriophage it include 6…
Q: Question 4 (1 point) Metabolism refers to burning food during physical activity like running.…
A: The true answer is... All of these (e)
Q: Give an example and explanation of how niche differences related to diet are manifest in differences…
A: Introduction Niche:- It is the particular area within a habitat occupied by an organism, it is the…
Q: Female Drosophila with cinnabar eye (cn) and vestigial wings (vg) were mated to males with roof…
A: Answer given in step 2 onwards. As per our guideline i can answer only 3 subpart only but I gave you…
Q: The sodium pump is an example of a catabolic process. an anabolic process. stored energy. a. b. C.…
A: The sodium-potassium pump is an example of an active transport membrane protein/transmembrane…
Answer the question in the attached picture:
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as is true under certain test tube conditions). 5' GTAGCCTACCCATAGG 3' What is the complementary DNA strand? 2. Suppose mRNA is transcribed from this DNA using the complementary strand as a template. What will be the sequence of the mRNA? 3. What would be the corresponding anticodons? 4. What peptide would be made if translation started exactly at the 5' end of this mRNA?A. Consider the following DNA sequence (coding strand) located near the middle of the coding region of a gene in lampreys. The numbers atop the nucleotides represent the position # of a nucleotide. The underlined nucleotides denote a codon in frame. The figure also identifies the sequence of a complete intron. DNA 50 55 60 65 70 75 80 85 5' - CCTGAGTCCGAGGGTGAACGAG TAGTAGTAGTAGTAGTAGTAG- 3' Intron A. Which of the following is almost certain to result in a shorter than normal DNA? You may choose than In event, explain choice(s). more one answer. any your I. T→A mutation at nucleotide #59 II. G→T mutation at nucleotide #60 III. 3 nucleotide deletion in the middle of the intron IV. C>A mutation at nucleotide #54 B. In your opinion, could the intron sequence serve as a molecular marker? In your own words, explain your reasoning. C. Suppose the base at position 70 changes to A (adenine), would this be considered a mutation? In your own words, explain your reasoning.C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
- a. Use the genetic code provided in class to predict the sequence of protein formed from the following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA sequence being read shifts rover by a base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? GCUACAUCUUUA c. If a gene mutation results in a point mutation, meaning a single nucleotide is converted to a different nucleotide base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? CGCUCCAUCUUU d. Which mutation is more likely to result in a slightly altered, but still functional, protein, the frame shift mutation or the point mutation? Briefly explain your answer.a. Use the parent strand as a template to synthesize mRNA strand. Describe how the mRNA strand is generated and regulated. Indicate the direction of synthesis. b. Synthesize a polypeptide from the mRNA.This is a missense mutation. Include the ideas of transcription and translation. Compare the normal and abnormal strands.
- A gene is about to be transcribed. Draw a cartoon/ diagram of double stranded DNA that contains this gene, and indicate where in this DNA corresponds (or will correspond to after transcription): promoter, 4 exons, 4 introns, start of transcription, start of translation, start codon, and stop codon.b. The process by which the DNA instructions are converted into the functional product is called gene expression. Transcribe the DNA below into mRNA. A [Select ] G [ Select ] G [ Select ] T [ Select ] [ Select ] A [Select ] c [ Select ] T [ Select ] G [ Select ] > > > > > > > > >A. =. A Styles Sensitivity Font Paragraph Dictate 7. What are three differences between RNA and DNA? 7. Where is DNA found in the cell? Where is RNA found in the cell? 8. Name the three types of RNA. What is the function of each? Do they function in transcription, translation, or both? 10. What are the steps of transcription? 11. What are the steps of translation? 12. If this is the base sequence of DNA, what is the resulting AA sequence for the following mutations, where mutations and insertions are bolded and deletions are indicated with DNA TAC CGC T C C GCC G T C GA C A AT АСС Аст Mutations: DNA TAC CG C TC C GC C GT C GAC ACT AC C A CT DNA TAC CGG T C C GC GT C GAC A aT ACC AC T DNA TAC CG- T C C GC GTC GACAAT ACCAC T DNA TAC CG CA T CC GCC G T C GACA AT AC ACT What are the consequences of each of these mutations for protein structure? Page 2 of 2 458 words Focus 100%
- Analysis of a mRNA sample showed that 18% of the nitrogen-base molecules present were uracil molecules. The DNA molecule that was transcribed to form the mRNA sample would most likely contain Select one: a. 18% adenine b. 18% cytosine c. 32% thymine d. 32% adenine O O OFor each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.II. A double-stranded DNA molecule with the sequence shown below can produce a polypeptide that is four amino acids long. Identify which DNA strands are the coding and the transcribed template strands by circling C or T to the left of the table below, respectively. Use an arrow to indicate the direction of transcription. In the table, show the mRNA sequences and amino acids in this peptide. In spaces to the left and right of the table, label all 5' and 3' ends of all relevant nucleic acid strands. READ CAREFULLY: The table gives you the possibility of filling in answers that show transcription from either strand or in either direction. You are only required to fill in the information relevant to ONE PEPTIDE (no others). Refer to the genetic code on the following page. HINT: While we read and write in 2D from left to right, in the 3D world of a cell there is no such restriction on reading and writing associated with transcription or translation. AA mRNA TCA CGG AAT TTC TAG CAT GTA C or…