1. One strand of DNA has the base sequence: C G A T T G G C A G T C A T. Determine the sequence of bases in the complementary strand of mRNA that would form next to this DNA strand. a. Write the sequence of bases in the complementary mRNA strand below. ___________________________________________________________________________

1. One strand of DNA has the base sequence: C G A T T G G C A G T C A T. Determine the sequence of bases in the complementary strand of mRNA that would form next to this DNA strand. a. Write the sequence of bases in the complementary mRNA strand below. ___________________________________________________________________________

Name: 1. One strand of DNA has the base sequence: C G A T T G G C A G T C A
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. One strand of DNA has the base sequence: C G A T T G G C A G T C A T.Determine the sequence of bases in the complementary strand of mRNA that would form next to this DNA strand.a. Write the sequence of bases in the complementary mRNA strand below.

3-2-1 Code It

6th Edition

ISBN:9781337660549

Author:GREEN

Publisher:GREEN

Chapter2: Introduction To Icd-10-cm And Icd-10-pcs Coding

Section: Chapter Questions

Problem 3MC

See similar textbooks

Similar questions

Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
Write the CODON that corresponds with each amino acid. There may be more than one. The full names are written, but the codon chart only shows the first three letters. glycine ______________________ phenylalanine ______________________ arginine ______________________
Writing a Full Strand:1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT Complementary DNA:_______________________________________________________________________ B. Make identical strands of DNA CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT (original) ______________________________________________________________________ (new) _____________________________________________________________________ (new) ______________________________________________________________________ (complementary from 1A)2. A. Original DNA: CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT Complementary DNA: _______________________________________________________________________ B. Make identical strands of DNA CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT (original) _______________________________________________________________________ (new) ________________________________________________________________________ (new)…
DNAT A C C A C C C C C G T A T G G C T G G G A A T A T C mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
DNAT A C C G C C C C A T G A T G A A T A C C G G G A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
DNAT A C C G C T C C G C C G T C G A C A A T A C C A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________
Complete what is being asked and finally with the Genetic Code table, determine what specific amino acids will be finally formed. Given DNA strand 3’ T A C T A G C C T A C T G C G 5’ 1. The partner strand of the given _________________________________ 2. The mRNA strand formed _____________________________________ 3. The tRNA _________________________________________________ 4. The amino acids formed are __________________________________
write a correct terminology/word on column B that meet the description of column A COLUMN A COLUMN B 1. The site for protein synthesis where mRNA and tRNA meets. 2. Benign tumours or warts that might cause problems but do not spread to oyher parts of the body. 3. A nucleotide sequence that is complimentary to the mRNA codon. 4. A condition that depicts injury or diseased state of liver. 5. Term used to describe a process or condition which affects the general body function. 6. A type of virus that attacks the respiratory system to cause flue 7. The fluid found within the cell 8. A condition which describes harm, damage or impairment of kidney function. 9. To spilt a molecule or chemical bond. 10. The protein coat or shell of a virus
What is the resulting polypeptide: _______________________________________________________? What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide. Is this more or less harmful than the previous mutation in step #10? Why?