Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code provided, list the amino acid sequence at the end of translation. Show how you got your answer.
Q: Order of Order of Order of Amino Acid bases bases in MRNA | (codon) bases Coded into in DNA in TRNA…
A: As we know DNA contains A T G C Bases and RNA Contains A U G C Bases. mRNA is complementary to DNA…
Q: A DNA antisense strand contains the following nucleotide base sequence: CGA TTT GGT TGA From…
A: A single-stranded RNA molecule that is corresponding to one of a gene's DNA strands is referred to…
Q: Translation always begins by adding a methionine to the beginning of every
A:
Q: Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the…
A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…
Q: Compare the process of Replication, Transcription, and Translation by describing the following…
A: In the molecular biology, the genetic information is encoded in the DNA. Central dogma consists of…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…
Q: Refer to the double stranded DNA molecule with the sequence below to answer the following questions:…
A: The process of conversion of deoxyribonucleic acid (DNA) into ribonucleic acid (RNA) is called…
Q: Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of…
A: Any detectable, inheritable qualitative or quantitative change in genetic material of an organism…
Q: For the following DNA sequence TAC-CCC-AAA-TTT-ATC Write: the mRNA codons the tRNA anticodons…
A:
Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. During…
A: Translation, in molecular biology and genetics, is the mechanism by which ribosomes in the cytoplasm…
Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…
A: The process of producing protein by association of mRNA and ribosomes is called translation. The…
Q: Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart…
A: The series of mechanism by which a DNA sequence is is transcribed into RNA, and mRNA is translated…
Q: Complete the following table and answer the next two questions. DNA____________ strand T…
A: The process of synthesis of RNA with the help of complementary strand of DNA is called…
Q: Label the 5' and 3' end of each nucleotide and approximate where the start point (+1) would be on…
A: The process shown here is called transcription. In this process a molecule of mRNA is synthesized…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…
Q: In the DNA sequence,the bottom strand is a template strand.if the base pair
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the…
A: DNA serves as the genetic material and carries genetic information from one generation to another.…
Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…
A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…
Q: Which letter in the image represents the end product and the process of translation
A: Answer: CENTRAL DOGMA : It is the process of replication , transcription and translation of DNA.…
Q: If given the following coding strand of DNA, what is the mRNA? What tRNA will be present? (hint -…
A: DNA is a hereditary molecule made up of two polynucleotide chains lies in the nuclues of all…
Q: create a summary of the nucleotide pairs during the translation process
A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…
Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…
A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…
Q: Describe in Your own words the Termination step of Translation process
A: Proteins are polypeptide molecules synthesized by the translation of mRNA in the ribosome.…
Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…
A: The process of translation in involves three steps - (A) Initiation: it involves binding of a small…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation?*
A: A termination codon or a stop codon is a group of three amino acids that is present in the mRNA that…
Q: Use the codon wheel on page 10.11 to identify any stop codons in the stop codons. Use the codon…
A: During transcription process RNA is formed with the help of complementary base pairing with template…
Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…
A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…
Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…
A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…
Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: When can a mutation on the DNA cause shortening of the translation product? Give a specific example…
A: Mutation is an alteration in the nucleotide sequence of a gene / DNA . It can result from DNA…
Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…
A:
Q: Using the genetic code, interpret the following set of nucleotides.…
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!) tRNA anticodon (No thymine in…
A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…
Q: What do you call the process of making chains of polypeptides out from RNA strand? Group of answer…
A: Nucleic acids are defined as the type of natural chemical compounds that play a major role in…
Q: All of the following are directly involved in translation excepta) promoter. b) ribosome.…
A: Introduction: The chemical nature of genes, such as genetic information encoding, gene expression,…
Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…
A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…
Q: Drag and drop the following terms into the correct spots on the image below. 1. Amino Acids 2.…
A: Ribosomes are responsible for the production of proteins. They accomplish this through a process…
Q: Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space…
A: b) UUA: Leucine c) GAG: Glutamate d) UAU CUA: Tyrosine-Leucine e) AUC UUG: Isoleucine-Leucine
Q: Explain the three steps (Codon recognition, peptide bond formation, translocation) in elongation…
A: The translation is the biological process that involves the conversion of the genetic information in…
Q: following is a series of DNA triplets. first, transcribe the correct complementary sequence of mRNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: The following DNA strand is bound to transcription and translation. Give the translated 5-letter…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotide…
Q: Use the following sense DNA sequence 5'- ATGTCCTGGTAA-3' to answer the following questions below.…
A: A) The resulting polypeptide from the mutated DNA sequence is- 5'-ATGTCCTGGTAA-3' Sense DNA…
Q: Each one gives some basic information and summarizes its main role in translation. rRNA:…
A: The synthesis of protein or polypeptide chain from the mRNA sequence (that contain genetic codon) is…
Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…
A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…
Q: Below is a short segment of a DNA molecule. Transcribed the DNA codon into mRNA. Use your data sheet…
A: Transcription is the process by which RNA polymerase read out DNA template stand and synthesize…
Q: Each one gives some basic information and summarizes its main role in translation. mRNA:…
A: The central dogma was proposed by Francis Crick. There are three major processes: replication,…
Q: Transcription and translation both involve an initiation, elongation, and termination phase.…
A: Answer (1) :- Fragments of DNA that are responsible for different traits are known as genes. The…
Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: DNA T A G strand DNA G G strand MRNA codon U TRNA anticodon A Amino acid Alanine Glutamate
A: Genomic DNA contains information about the genes. DNA is a double-stranded molecule composed of two…
Q: DNA TAC - GGC - GAA - TCC - CCA - GTA - TCC - ATT ТСС - ТСС - АTT (gene) MRNA AUG Amino Acid Met…
A: DNA => Transcription => mRNA => Translation => Protein Transcription: Formation of RNA…
Shown below is a DNA coding strand:
5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3'
Using the genetic code provided, list the amino acid sequence at the end of translation. Show how you got your answer.
Step by step
Solved in 2 steps
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
- On the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterThe following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2.Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide.
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GChoose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post-transcriptional processing. Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference. DNA strand: 5'-TCGAAACGAGCTGCAGCTAGCTAGCTACGTCAGCTGCATCTGTCTACGAGCGACTGTCTAGCATAGCGTAGCTGC-3 'Complementary strand: 3'-TCGAAACGAGCTGCAGCTAGCTAGCTACGTCAGCTGCATCTGTCTACGAGCGACTGTCTAGCATAGCGTAGCTGC-5'Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.