PCR and DNA Fingerprinting22. Below is a DNA double helix coding for a very small polypeptide.5 NontemplateStrand3'TTTTATGCGCCCCAGTAAGTAATGACTAEat is the direction of thAAAATACGCGGGGTCATTCATTACTGAT-Templateintrator codon.UUTILAU GOGESSAImesacorwhich end of the mRNA IS transcribed first? 53'Strand5'g the 5' and 3 ends) and circle thee. Identify the maximum number of amino acids in a polypeptide chain produced by aDNA containing 225 nucleotides.212codons UÇA, UAA, and UAG code for which amino acig. If a polypeptide is 210 amino acids long what is the minimum number of nucleotidesin the mRNA molecule required for the synthesis of that chain?

Name: PCR and DNA Fingerprinting22. Below is a DNA double helix coding for
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: PCR and DNA Fingerprinting22. Below is a DNA double helix coding for a very small polypeptide.5 NontemplateStrand3'TTTTATGCGCCCCAGTAAGTAATGACTAEat is the direction of thAAAATACGCGGGGTCATTCATTACTGAT-Templateintrator codon.UUTILAU GOGESSAImesacorwhich

DNA also known as deoxyribonucleic acid, is the molecule that houses the genetic instructions…

Science

Biology

e. Identify the maximum number of amino acids in a polypeptide chain produced by a DNA containing 225 nucleotides. UAA, and UAG code for which amino acid? STOR g. If a polypeptide is 210 amino acids long what is the minimum number of nucleotides in the mRNA molecule required for the synthesis of that chain?

e. Identify the maximum number of amino acids in a polypeptide chain produced by a DNA containing 225 nucleotides. UAA, and UAG code for which amino acid? STOR g. If a polypeptide is 210 amino acids long what is the minimum number of nucleotides in the mRNA molecule required for the synthesis of that chain?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

R and DNA Fingerprinting {T} MYEN 22. Below is a DNA double helix coding for a very small polypride. 5' Nontemplate Strand L TITTATGCGCCCCAGTAAGTAATGACTA AAAATACGCGGGGTCATTCATTACTGAT 3' Template Strand 5' 212 3' a. What is the direction of synthesis for the mRNA? b. Draw the m-RNA that would be transcribed (labeling the 5' and 3' ends) and circle the initiator codon. c. Which end of the mRNA is transcribed first? d. Using the genetic code table, list the amino acid sequence resulting from this mRNA. e. Identify the maximum number of amino acids in a polypeptide chain produced by a DNA containing 225 nucleotides. f. The codons UGA, UAA, and UAG code for which amino acid? g. If a polypeptide is 210 amino acids long what is the minimum number of nucleotides in the mRNA molecule required for the synthesis of that chain?
Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
Format Tools Add-ons Help Last edit was seconds ago Arial BIUA Normal text 11 1 3 Which of the following molecules|are involved in gene expression? Choose all that apply. O RNA polymerase O Splicing O Primer O Origin O Stop codon O Start codon O Parental strand O IRNA O Okazaki fragment O Bubble OFork O Leading strand O Helicase O DNA polymerase OA site O Amino acid attachment site O Primase O Primer O Terminator sequence MAY 18 étv A MacBook Air
3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.
5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgtc-5 The diagram above shows an RNA primer hydrogen-bonded to a DNA template. Which letter indicates the site where DNA polymerase would add nucleotides to this structure? OA OB D Any of these is possible C
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’>3’ direction.
5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’3’ direction.
Template strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter
Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU GCC AUU GCA GCU AAA CAC UUC GAG CCC UGU- 3’ What is the polypeptide sequence?